Генноинженерная Ш биотехнология 
У Д К 577.1 
V. A. Kordyum, V. V. Frolkis, L. L. Lukash, 
V. N. Shulzhenko, S. P. Shpilevaya, I. Е. Kostetsky, 
Т. G. Titok, I. S. Varsanova, L. I. Likhacheva, D. М. Irodov 
CiFNE THERAPY OF MASS PATHOLOGIES 
The whole complex of investigations is described that allows to run the way from the 
idea to experimental realization of a fundamental possibility of gene therapy and its 
application to mass pathologies on the sample of insulin-dependent diabetes and athe-
rosclerosis. 
The search and analysis were performed of such regulatory elements that whould 
permit an expression irrespective of the state of a general cell regulation. 
Expression of the implanted gene material is shown on cells of different tissues 
atid different organisms and also in vivo (both the model gene of $-galactosidase Esche-
richia coli and insulin- and apolipoprotein high density Al-coding genes related to 
above stated pathologies). It is concluded that the results obtained in the culture outsi-
de the organisms shouldn't be extrapolated on the animals, i. e. on the organism's level. 
The expression of recombinant molecules is shown to be ambiguous and depend 
on gene's surroundings and the type of recipient cells. Both in the culture and in the 
organism the individual cell heterogeneity is observed in the quantitative characteristics 
of the expression of gene implanted from outside. Besides, an individual organism and 
age heterogeneity with regard to the expression of the exogenous gene is reported. 
The conclusion is made about the necessity to individualize gene therapy of mass 
pathologies. 
Introduction into the problem. Gene therapy has passed for almost 20 
years of its existence an exceedingly bright and sometimes dramat ic 
way. However now when it has achieved a level of the practical realiza-
tion its pioneering significance for the medicine is evident. But medicine 
on the whole being on its level and biomedicine as its advanced trend in 
par t icular are far more ahead with qualitatively new problems in store. 
Now we witness practical development of the human biotechnology, i. e. 
the technology of the direct t ransformat ion of human whose aim is a bio-
logical reconstruction of a man as an individual. Terms (direct biotech-
nology of a man) and the aim (biological reconstruction of a man) are 
still new and unusual . Just as the term «gene engineer ing of human» 
(followed by the term «gene therapy») and especially tasks and potenti-
alities of the technology behind the terms caused professional contradic-
tions of specialists and shocked the public new problems may also first 
cause indignation. Nevertherless the experience of the human civilization 
shows that nothing can stop the new in science. One may surely predict 
that biotechnological t ransformat ion of human with all its methods and 
potentiali t ies will soon become habitual . 
Direct biotechnology of a man embraces the technology of cell im-
plantat ion, reproduction technologies, technologies of artificial o rgans 
and tissues, etc. But gene therapy is most radical trend that essential ly 
interacts with all the rest and unites all in one. It has s tar ted from theo-
retical and experimental substant ia t ion of t rea tment of classical mono-
genic heredi tary diseases gradual ly expanding its activities to all the 
processes proceeding in human organism. Previously we formulated a 
concept of gene therapy of mass pathologies [1, 2]'. So almost all human 
© V. A. Kordyt im, V. V. F r o l k i s , L. L. Lukasl i . V. N. S h u l / h e n k o , S. P . S h p i l e v a y a , I. E. K o s t e t s k y , 
T- G. T i t o k , I. S. V a r s a n o v a , L. I . L i k h a c h e v a , D. M, I r o d o v , 1993 
I S S N i./2oo-7057. Б И О П О Л И М Е Р Ы II І \ЛЕТІ \А . і993. Т. 9. № 4 
diseases are in the sphere of potentiali t ies of gene therapy. However 
mass pathologies require a specific approach whose peculiarities are not 
only pure methodical but also fundamenta l . 
The first (and conceptually the main) peculiarity is a fundamenta l di f fe rence in m o n o g e n e heredi tary diseases and mass pathologies. In the 
first case there is a par t icular defect in a part icular gene. So, the whole 
problem (no mat ter how complex it would be) is reduced to elimination 
of this defect (either by alteration or by complementat ion at the expense 
of introduction of a sound gene under the same outside regula t ion) , in a 
case of mass pathologies genes themselves are not distorted. Something 
as a rule unknown at the level of pr imary processes is happening with 
the regulat ion system which dis turbs funct ioning of these or other sys-
tems of the organism. Though, finally, it affects funct ioning of particu-
lar genes but the genes themselves either unchanged or changed in few 
cells (for example tumor ones) or these changes are not functionally 
essential . 
So, in most cases a simple introduction of a gene will have no ef-
fect. One should create such molecular construction where the introdu-
ced gene will function despite of the changed regulat ion that makes the 
same sound organ ism's own gene available in a cell function poorly. 
The second difference (also conceptual) is as follows. In case of 
classical monogenic diseases the damage is available only in one gene. 
The processes in the organism are controlled by corresponding metabolic 
chains whose activity is specified by gene ensembles. All genes in each 
of these ensembles act normally except one par t icular gene. It is enough 
to alter one par t icular gene (or to complement its activity) and the meta-
bolic chain will become sound. 
It is assumed for mass pathologies that the whole metabolic ensemb-
le, a metabolic chain and often many metabolic chains are in a disba-
lance. So, the question is here what one should do in this si tuation since 
it is impossible to complement all genes. 
However the analysis of metabolism shows the following. Metabo-
lism is organized so that there is a small number of key control l ing pro-
cesses able to a considerable extent to el iminate or to smooth damage of 
the rest links of the chain. So the concept of gene therapy of mass patho-
logies is underlain by an idea of key a r res t ing processes and, respective-
ly, the genes coding them. But this concept must be experimental ly 
confirmed. 
Finally, in case of heredi tary diseases the gene is defect from birth 
and even earlier — from gamete and will never af ter by itself. So it must 
be altered (complemented) for the rest of life. In most cases of mass 
pathologies the gene capable to stop pathology (as the rest of the genes 
from the damaged ensemble) is sound. It needs no al terat ion but only 
complement ing for the period until o rganism normalizes its processes. 
Though disfunct ion of the gene in this case is not prolonged still the or-
ganism needs time to normalize its processes and this t ime will vary in 
different cases. For young it will be short (all processes in this period 
normalize rather quickly). For middle age (and even for young but with 
chronic disease when the organism is exhausted) the time for normaliza-
tion is increased. But with gene therapy of age pathologies and diseases 
specified by the death of nonrestored cells the presence of the introduced 
gene must be permanent . So, if for classical gene therapy the introduc-
tion system must provide a permanent stay and funct ioning of the intro-
duced gene mater ia l then in a case of mass pathologies it is necessary to 
have all var ia t ions of the stay of recombinant molecules in the organism 
cell — from short- term to permanent . It needs addit ional methodical 
designs. 
As a result of the performed complex studies we have succeeded to 
run the way from the idea to experimental realization of a fundamenta l 
possibility of gene therapy of mass pathologies. This work describes 
this way. 
ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Nb 4 5 — 3-624 2 
Materials and methods. S t r a i n s , m e d i a . S t ra ins Escherichia coli 
(HB1Q1, D H l , JM101, LE392) and yeasts Saccharomyces cerevisiae LL20 
used in the work were obtained from the collection of cultures at ihe 
Inst i tute of Molecular Biology and Genetics of the Academy of Sciences 
of Ukraine. A library of the human genes were received from N. S. Nez-
nanova (Inst i tute of Molecular Genetics of the Russian Academy οι Sci-
ences, Moscow). 
S tandard methods for growing of microorganisms and cultivation of 
,somalie cells on corresponding media are used in the work [3, 4] . 
Cells of embryonal human lung LEH, diploid f ibroblasts of human 
skin SL, cultivated mouse cells of C3H10TI/2 and C3HLtk~ lines and 
cultivated cells of Chinese hamster of Bild-ii-FAF28 line of clone 237-
8Glu~ts were the object of investigation. LEH and C3HLtk~" cells were 
obtained from the collection of the Inst i tute of Virology of the Acadeniv 
of Medical Sciences of Russia, cells C3H10TI/2 and 237-8Gl t r t s — from 
the Inst i tute of Molecular Genetics of the Academy of Sciences of Russia , 
cells SL — from the Michigan State University, USA. 
P l a s m і d s. Three initial p lasmids for producing the rest of recom-
binant DNA were used in the work. These are pUC18 from the Inst i tute 
of Molecular Biology and Genetics of the Academy of Sciences of Ukra-
ine, a s t andard commercial vector for cloning of DNA, pALl, a derivative 
f rom pUC18 conta ining one human α/w-repetition by BamHI-s i te of a poly-
linker presented by Ν. V. Tomilin (Inst i tute of Cytology of the Aca-
demy of Sciences of Russia , S. Pe te r sburg ) , pYF92 [5] used for cloning 
of ARS-sequences of DNA presented by V. L. Larionov (Inst i tute of Cy-
tology of the Academy of Sciences of Russia, S. Pe te r sburg ) . 
DNA of plasmid pGA293 kindly presented by Dr. Siminovich (Ca-
nada ) and pCH 110 conta ining IacZ gene of E. coli that codes a synthesis 
of bacterial β-galactosidase were used in the experiments on study of 
bacterial β-galactos idase expression [6]. Construct ion of pAG293A is a 
plasmid pGA293 with α/α-repetition cloned by BamHI-site while plasmid 
pGA293ZA is devoid of EcoRI-fragment conta in ing IacZ gene. 
Besides we used also plasmids pLZ56 and pHB320, pH$21. P lasmid 
pLZ56 was obtained from V. Korobko (Shemyakin Inst i tute of Biological 
Chemistry of the Russ ian Academy of Sciences, Moscow). It contains 
IacZ gene of E. coli and was used in the control of tandem of earlier pro-
moters A2 and A3 of phage T7. Plasmid pHB320 was obtained from 
Dr. E. Gren (Inst i tute of Organic Synthesis of the Latvian Academy of 
Sciences, R iga ) . It is pBR322 with a full DNA replica of hepati t is virus 
ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Nb 4 5 — 3-624 65 
В. This plasmid was used to construct ρΗβ21, its construction scheme is 
presented in fig. 1. 
Gene of human insulin containing a promoter but without a regula-tory site providing' t i ssue-specif ic i ty of the expression (Bgli /-Гш//-Frag-
ment) [42] was cloned in the bacterial plasmid pBR322ins and pAins 
(the latter contains α/α-repetit ion). 
Besides in a number of experiments we used a recombinant construc-
tion on the base of hepatotropic vector pGins and restriction f ragment of 
DNA conta in ing insulin gene ( ins) . 
Screening of the human genes library, manipulat ion with plasmid 
DNA and obta in ing recombinant molecules were realized by the conven-
tional procedure described by Mania t i s [7]. Fourty-member oligonucleo-
tide synthesized at the Inst i tute of Molecular Biology and Geneiics of 
Fig". 2. Samples of some plasmid cons t ruc t ions used in exper iments 
the Academy of Sciences of Ukraine and complementary to the structu-
ral part of the human gene was tised as a probe. Construct ions of the 
main used plasrnids are presented in tabl. 1 and fig. 2. Plasmid DNA 
was isolated from the yeast cells as recommended by Glover [4]. P lan t 
DNA was isolated as described in [8]. 
P r imary DNA structure was determined by the Alaxam — Gilbert 
method [9]. 
E n z y m e s . Restriction endonueleases and the KJenov f ragment of 
DNA-polymerase I were received from the Scientifie-Produclion Associa-
tion «Ferment» of the Research inst i tu te of Applied Enzymology (Vil-
n ius ) . DNA-Iigase of phage T4 was kindly given by B. Troyanovsky and 
Yu. Gorlov (Inst i tute of Molecular Biology and Genetics of the Academy 
of Sciences of Ukraine) . 
L i p o s o m e s . Negatively-charged monolameiiar liposomes from 10 
to 100 nni in size were used as DNA carrier. They consists of ( % ) : Ieci-
tin — 70, cholesterin — 20, dicethylphosphate — 9, phosphatydvlamine — 1. 
Concentrat ion of lipids was 20 mg /ml . Piasmid DNA was enclo.-.ed into 
the liposomes by the method of Ca-fusion. The quanli ty of DNA enclosed 
66 ISSN 0233-7657. Б И О П О Л И М Е Р Ы I i КЛЛТКЛ. 9. No 4 
into the liposomes was 7—10 % of the introduction amount . Sizes, lamel-
lat ion and preservat ion of liposomes were controlled by means of electron 
microscopy of slices [10]. 
P r o d u c t i o n a n d p u r i f i c a t i o n o f i m m u n e s e r u m s . 
Chinchilla rabbits were vaccinated with' purified β-galactosidase isolated 
from E. coli. Inject ions were made into cervical and popliteal limph no-
des For the first vaccinat ion we used a complete Freund ad juvan t , for 
the second and third ones — an incomplete ad juvan t . Buster inject ions 
were performed intravenously. Each animal was injected with 0.5 mg of 
β-galac tos idase for the whole 
vaccinat ion cycle. Blood was 
taken on the 6-7th day after 
the last injection. Titer of 
antibodies was determined 
by the method of binary dif-
fusion in agar . 
To obtain gamma-globu-
lin fract ion the rabbit serum 
with t i t res 1 : 32 and 1 : 16 
were two times precepitated 
by ammonium sulphate with 
33 %-satura t ion, dialyzated 
aga ins t 0.0175 M of na t r ium-
phosphate buffer, pH 6.3, 
and purified by pass ing 
through the column of DEAE 
cellulose (1 .5X25 cm) with 
the same buffer being used. 
Fraction of IgG taken from 
the ion-exchange column was 
concentrated by PEG (35 000-
40 000) and kept at 4 °С 
with added 0.1 % NaN3 . 
Under immunof luores-
ccnt s ta in ing of cytological 
prepara t ions (hepatocytes, L t k - and other cells) the IgG fract ion 
was addit ionally purified dur ing an hour by the hepatic powder [11]. 
The donkey ant i rabbi t globulin labelled by f luoresceinisolhiocyanate 
(FITC) was released from a nonbound fluorochromium on 1 % agarose . 
Working dilution of the rabbit serum to a bacterial β-galac tos idase is 
1 : 10 luminescent serum — 1 :16 under s ta in ing of cytological prepara t ion . 
Determinat ion of human apoAl in cell culture of mammals was per-
formed by the s t andard immunoenzyme method [12] us ing rabbit anti-
serum to the human protein Al and conjuga te on the base of horse-raddish 
peroxidase. 
P r o d u c i n g of p r i m a r y c u l t u r e s of h e p a t o c y t e s 
a n d k e r a t i n o c y t e s . For production of hepatocytes we used the li-
ver of 2-week rats . The liver was taken, washed in the Henks solution 
with antibiotics and ground. Then it was t reated dur ing 10 min by 0.02 % 
col lagenase solution, pipetted and precipitated dur ing 35 s under 1000 
RPM. Cells were inoculated into the Petr i dishes by 2 mill and placed 
into C0 2 - incuba tor at 37 °С. In three hours the detr i tus was removed 
from the Petri dishes and the medium was changed. When the monolayer 
was formed the cells were once again inoculated and then aga in 
t ransfected. 
Keratinocytes were grown from skin slices taken by biopsy us ing 
feeder layer. Cells 3T3 formed by gamma-rays were used as feeder cells» 
Skin slices were cut in the Eagle medium with 10 % of serum and then 
ground. Then they were treated with 0.25 % solution of trypsin at 37 0C. 
Each 30 min we let the skin crumps precepitate dur ing 1 min with follow-
ing removal of superna tan t fluid and its replacement by fresh trypsin. 
T a b l e 1 
Used molecular constructions 
P l a s m i d E x p e r i m e n t s t h e y are used in 
pGA293 
pGA293Z 
pGA293A 
pCHllO 
pCMVfi 
pH$21 
pHB320 
pLZ56 
pBR322 
pBR322ins 
pPins 
ρ Ains 
ρ G ins 
pALl 
ρ ALlapo 
pAAA 
pUC18 
ρ JJ C18 α ρ о 
pUClSapo' 
ρ YF92 
Study of the expression of bacter ia l 
gene of β -ga lac tos idase on the cul-
tu re of cells and mode] an imals 
S t u d y of the expression oi h u m a n 
insul in gene in the cul ture of 
cells and model an imals 
S tudy oi the expression oi human 
gene apoAl on the cul ture of cells 
and model an imals 
I S S N 0233-7657, Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1PQ3. Т. 9. № 4 67 
Then [he cells were precipitated from the superna tan t fluid and resuspen-
aed in the growing medium conta in ing 20 % of serum from cattle embryo 
and hydrocort isone (0.4 i.ig/rnl). This procedure promoted growing of the 
cells. After this the epidermal cells were mixed with the suspension of 
feeder cells and put into the dishes. Epidermal cells needed 2-8 days for 
set fixation. The medium w a s changed twice a week. Growth of "fibro-
blas ts in these conditions was supressed while the epidermal cells for- ; 
med colonies of kerat inocytes l ining the feeder layer towards periphery. 
For repla t ing of kerat inocytes the culture was t reated by 0.02 7o 
EDTA d u r i n g 15 s and intensively pippeted for a selective removal of 
f ibroblasts . Then the kerat inocytes colonies were desagregga ted by 0.02 % 
EDTA and 0.05 % trypsin ( 1 : 1 ) . New feeder layer was added for reino-
culation in case of need. 
T r a n s f e c t i o n 1 Transfect ion of cells by plasmids with the insu-
lin gene was performed by the calcium-phosphorus method [13j. Con-
centrat ion of the t rans formed DNA was 10 \ig/ml for 1 mill of cells. In 
some experiments we used the her r ing milt DNA (commercial prepara-
t ion) . Calcium-phosphate precepitate was applied on the subcontinent 
s ta te cells usual ly af ter 2-3 days af ter their inoculation into the g lass 
f lasks. Cells subjected to mock-injection and cells injected with initial 
p lasmids used for construct ion of recombinant DNA acted as a control. 
The cells were cult ivated in the Eag le medium with addit ion of 10 % 
bovine serum either embryonal or f rom adults . The content of the protein 
product was determined in the samples of the cul tural medium by Ше 
immurio-enzyme method. With this aim we made probes dur ing 16 days 
af ter the t ransfect ion and in the process of growth of the t ransiected 
cells. Before sampl ing the cells were washed twice by the Eagle medium 
and a portion of a fresh medium with an increased glucose content (IBOw-
2000 m g %) but without serum was added. In a day af ter this procedu-
re we collected medium from each flask separately and determined a con-
centrat ion of the protein-product . Concentrat ion of glucose in the samp-
les of cul tural medium was determined by the s t andard o-toluidine method. 
Stat is t ical processing was performed by the Fischer, Vilkockson and χ2 
cri teria. 
Transfect ion of L t k - cells by plasmids conta in ing IacZ gene under 
different promoters is carried out for cytological s tudies on 1-2 day cell 
culture inoculated on the s igmenta l glasses. Cells were fixed in 4, 24 
and 72 h after t ransfect ion dur ing 20 min by some mixtures of acetone 
cooled to 4 °С. 
The recombinant p lasmids pAins and ρGins car ry ing hui nan ι η s її 11 η 
gene were used in the experiments on animals . DNA was implanted into 
the experimental an imals in a composition of liposomes prepared from a 
mixture of lipids: lecit in-cholesterin-dicetylphosphate ( 7 : 2 : 0 . 5 ) . A day 
before the experiment we enclosed recombinant DNA into the liposomes, 
prepared suspension of the liposomes in the physiological solution, freezed 
and then unfreezed them directly before the injection. Suspension of the 
liposomes (75 μg of DNA in 0.2 ml per individual) was injected directly 
into the right side of the liver af ter the autopsy of the peritoneal cavity 
with a subsequent pu t t ing in stitches on the muscle layer and skin under 
ester narcosis. Empty liposomes and physiological solution ac t ing as a 
control were injected the same way. Int raper i toneal injection is also used. 
The content of glucose in blood was determined by the glucosooxida-
se micromethod on an empty stomach us ing the device Glucofot. Immu-
noreactive insulin and C-peptide were determined by radioimmune method 
us ing the device r io- INS-PGU designed at the Inst i tute of Bioorganic 
Chemistry of the Academy of Sciences of Byelorus. The content of glucose 
in blood was determined before the injection of the prepara t ions and then 
in dynamics in 6, 10 and 24 h after injection. 
Experiments in vivo were performed on mice, rabbits, piglets and 
rats . For each var ian t of the experiment we prepared a group of 2 month 
mice oi BALB/c line (4—5 specimens) . Each experiment was repeated 4 
6 8 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. H>P3. Т. Л- 4 
t imes of the mean. The mate r i a l w a s injected into a l a rge lowe· lobe of 
the liver. Local izat ion of the necessa ry par t of the liver w a s found t h rough 
a section of the skin i n t egumen tum at a level of the o rgan . The per formed 
opera t ions produced no not iceable effect on the an ima l s . 
Volume of the ma te r i a l in jected into the mice liver w a s in all expe-
r imen t s 60 μΐ per specimen. In case of the in jec t ion of the p lasmid enclo-
sed into the l iposome the injected ma te r i a l w a s 300 μ g of l ipids and 
10 μ ^ of p lasmid DNA. Besides, in jec t ions of p lasmid pGA293 w i thou t 
l iposomes and only nonloaded l iposomes were made . In jec t ions of phy-
siological solut ion (10 m M t r i s -HCl , pH 7.5) were m a d e to ver i fy the 
a d e q u a t e react ions of a n i m a l s on admin i s t r a t ion of the exogenic mate -
rial . In tac t mice were control to the per formed v a r i a n t of the in jec t ion . 
I n t r a c u t a n e o u s in jec t ions of p lasmid pGA293 in composi t ion of the 
l iposome were m a d e into the ingu ina l region of mice and 14-day pigle ts . 
A vo lume of the injected ma te r i a l and a corre la t ion of p lasmid DNA and 
l ipids remained the same. 14-day pigle ts w e r e in jected with a mix tu re 
c o n t a i n i n g 3 m g of p lasmid DNA and 20 m g of l ipids, each by 2 ml. 
Imp lan t a t i on of the genet ic ma te r i a l wf th gene apoAl to exper imen-
tal a n i m a l s — adul t (6-8 mon ths ) and old (4.5-5 yea r s ) r abb i t s as well 
as adul t (6 months ) and old (26-28 months ) r a t s w a s carr ied out a di-
rect in ject ion into the liver. For in ject ion we used 0.3 ml of l iposome sus-
pension for each rabbi t per 1 kg of the live we igh t whi le for the ra t s — 
0.1 ml of l iposome suspens ion for 100 g of we igh t con t a in ing 13 m g of 
l ipids and 400 μ g of p lasmid DNA in 1 ml of suspens ion . Express ion in 
the implan ted gene w a s es t imated by m e a n s of the rocket Immunoelect ro-
phores is of the blood p l a sma of exper imenta l a n i m a l s with a specific an-
t i se rum to h u m a n apoAl and subsequent quan t i t a t i ve es t imat ion of the 
protein level by the control h u m a n se rum con t a in ing 1.25 m g / m l of apoAl 
[14] . Total eholester in w a s de termined in the blood p l a s m a by the Abell, 
Kiryakov and Tin terova [15, 16] while a per cent content of the f rac t ion 
of l ipoproteids — by the method of e lect rophores is in the a g a r o s e gel bv 
Kiryakov [17]. 
A n a l y s i s o f l i p o p r o t e i d s . L P of d i f ferent c lasses are iso-
lated by the method of p repa ra t ive u l t r a c e n t r i f u g a t i o n in the dens i ty g ra -
dient of N a B r [18]. The content of protein [19L tota l eholester in ( C h S ) , 
ChS es ters [20], phosphol ip ids (PhL) [21] w a s de termined in L P a f t e r 
p re l iminary ext rac t ion. 
Pro te in composi t ion of H D L P 2 and H D L P 3 f r ac t ion w a s s tudied by 
m e a n s of e lect rophores is in the g rad ien t of a po lyacry lamide gel (PAAG, 
3-27 %) in presence of DS-Na in the Na-phospha te buf fe r by the method 
described in [22] . P V P 2 and H D L P 3 p ro te ins a f t e r del ip idizat ion by a 
ch loroform-methanol mix ture were dissolved in the buf fe r [23] c o n t a i n i n g 
0.125 M of t r i s -HCl , ρII 6.8, 5 %i β -mercamoe thano l , 2 % DS-Na . Then 
they were heated d u r i n g 2-3 mi η in the boi l ing bath and aoolied on the 
celis of a vert ical P A A G block ( 1 6 X 1 8 X 2 ) by 30 μ! (30 pj of r, to ta l 
p ro te in) . Elec t rophores is w a s carr ied out at 25-30 °С d u r i n g 15-18 h. Gel 
w a s fixed, s ta ined wi th the 0.1 % Kumass i C250 and decolourized to re-
veal e lectrophoret ic zones. The gels were dens i tometr ized on the reg is te r -
ing microphotometer IFO-451. 
Microsomal f rac t ion of the liver w a s isolated by the method of diffe-
rent ia l cen t r i fuga t ion at 105 000 g [24] . The content of cytochrome P-405 
w a s de termined by the method of two-ray d i f fe ren t ia l spec t rophotomet ry 
on the spec t rophotometer «Perk in — Elmer» [25]. Monooxygenase acti-
vi ty of microsomes w a s revealed in vitro by a d d i n g hydroxyla t ion sub-
s t r a t e s — amidopyr ine and ani l ine [24] . 
P r e p a r a t i o n o f h e p a t o c y t e s . Mices were mort i f ied tempo-
ra ry in 1, 2, 3, 5 and 8 days unde r inject ion. For cytological p r e p a r a t i o n s 
we used the pa r t of the liver to where the ma te r i a l w a s injected. The fi-
nely-divided liver w a s washed of blood e lements , kept at least 30 min in 
the cold Na-ace ta te buf fe r (0 .88% NaCl , 0 . 7 % Na-c i t ra te , 0.1 % gluco-
se, 5 m g / m l of hepar ine , ρ IT 7.4) and used for hepa tocy te smears . Qual i tv 
ISSN 0233-7057. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Яв 4 7* № 
and density of the smears were checked under the light microscope. The 
smears were fixed dur ing 20 min by the acetone cooled down to 4 °С. 
Morphological preservat ion and functional activity of hepatocytes were 
checked on pa r t i cu l a r p r e p a r a t i o n s s t a ined by 0.2"%' Irvpsin bine. Yield 
of sound nondamaged cells of hepatocytes varied within 90-95 %. 
S k i n p r e p a r a t i o n s . For obta ining epithelium of the piglet 's 
skin the small g ra f t s of skin (5X5) were ground and 'Aaslied in iho 
Henks medium. Then the material was placed into the Versen mixture 
( trypsin 1 : 1 ) and kept dur ing 18-20 h at the t empera ture 4 °С. When 
the t rypsin-Versen mixture was changed the containers with the ground 
skin were macerated on a magnet ic mixer dur ing 30 min. Epithelial cells 
with f ibroblasts were isolated from the admixture of t issue remains by 
cent r i fugat ion at 1000 RPM dur ing 15 min. Cells were applied on the 
subject g lass and af ter fas ten ing they were fixed in three mixtures of 
cooled acetone dur ing 20 min. 
S t u d y of c y t o l o g i c a l p r e p a r a t i o n s . The expressions 
product of IoxZ gene in mice, hepatocytes was tested by indirect immuno-
fluorescent method (IF) [26]. The prepara t ions were studied on a lumi-
nescent microscope ML-2 with a photometric a t tachment under the wave 
length 520 nm with a probe 0.5 μίτι. The objective lens X70 for water im-
mersion were used for examinat ion of the preparat ions . A stained pro-
duct of IacZ gene expression fluoresced green in UV light. Glow intensi-
ty of each separa te hepatocyte was determined as a mean value from the 
probe measurement of three points in different sites of the cell cytoplas-
ma. Measurements for each experiment were made for at least 30-50 he-
patocytes with 4-5-fold repetition (on parallel p repara t ions) . The presen-
ce of bacterial β-ga iac tos idase in the t ransfected L t k - cells and hepato-
cytes was also detected by other cytochemical method-s ta in ing of prepa-
rat ions with ONFG [27]. 
I n d u c t i o n of s t r e p t o s o t o c y n e d i a b e t e s i n W i s -
t a r r a t s . Pre l iminary we developed a model of insulin-dependent dia-
betes in Wis tar ra ts us ing preparat ion streptosotocyne synthesized for 
this purpose at the Inst i tute of Molecular Biology and Genetics of the 
Academy of Sciences of Ukraine. Optimal conditions for inducing diabe-
tes were as follows· doses of prepara t ions from 55 to 70 ni.g per 1 kg of 
the live weight depending on the season. Streptosotocyne before admini-
s t ra t ion (not earlier than 30 min) was diluted in the acidic ci trate buf-
fer at pH 5.0. Males weighing 150-180 g were used for the experiments. 
It was established that s ingle adminis t ra t ion of streptosotocyne induced 
diabetes with a different degree of manifes ta t ion by glucose induces in 
blood and urine. Insul in-dependent diabetes became stable in 3 weeks 
af ter adminis t ra t ion of streptosotocyne in more than 70 % of animals 
IDDM manifes ted itself with a different degree — from light glycemia 
to the death of animals . It testifies to the individual sensitivity to the 
prepara t ion . Some animals did not fall ill. 
Results and its discussion. S e a r c h о f a ρ ρ г о a c h e s t o 
f u η d a m е η t а 1 s o l u t i o n s o n m o d e l o b j e c t s i n v i t r o . 
The first s t age is devoted to search of specific methods for solution of 
problems connected with the first peculiari ty of mass pathologies. It em-
braces search and analysis of such regulatory elements that would per-
mit an expression irrespective of the s ta te of a general cell regulat ion. 
It is necessary to check up different molecular construct ions in different 
types of cells. Studies are carried out on model objects us ing genes that 
are key ones for mass pathologies. Gene of β-galactos idase in E. coli is 
chosen as a marker (reporter) one. It is well different iated by antibodies 
of other cell proteins while cytoimmunochemistry and in par t icular cases 
enzymatic catalysis as the methods of its identification are well developed. 
An expression of genes in different types of cells (in vitro — HeLa, 
L t k - , pr imary cultures of hepatocytes and keratinocytes, in vivo — hepa-
tocytes, skin epithelium) is analyzed us ing well-studied promoters both 
tissue-specific and nonspecific. The first data have shown that even ho-
70 ISSN 0233-7657 Б И О П О Л И М Е Р Ы И КЛГ~ТТ<А. 1993. Т. 9. К? 4 
rnogeneous population under s t andard well-controlled conditions produces 
high heterogeneity by the expected response. Ability of IacZ gene in com-
position of different vector molecules to express bacterial β-galactosi-
dase in the culture of mice f ibroblasts and HeLa cells is tested by cyto-
chemical methods us ing indirect immunoenzymatic (IE) analysis . Con-
Fig. 3. Immunof luorescen t of Lt k~ cells af ter t ransfec t ion with plasrmds: 1 — pGA293; 
2, 4 — pGA293A; 6 — pGA293Z^; 3, 5 — pCHUO. 4 h af ter t ransfec t ion (1—3) and 
24 h (4—6). Control ( J ) nont rar i s formed ceils 
struct ions of the main recombinant molecules used in the work are pre-
sented in the section «Material and methods». 
As early as in four hours af ter t ransfect ion of L t k - cells by plasmids 
pCHllO, pGA293 and pGA293A one observes a bright fluorescence of cy-
toplasma in the green spectrum that testifies to the appearance of the 
bacterial β-galactosidase (fig. 3 , / , 2). Curves for luminous emit tance 
distr ibution of cells af ter t ransfect ion with these p lasmids is presented 
in fig. 4. In control var ian ts of tests when the culture of mice f ibroblasts 
is t reated with pGA293ZA p lasmids and in intact cells one observes no 
pronounced fluorescence of cytoplasma (fig. 3, 6", 7). Fluorescence inten-
71 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Nb 4 5 — 3-624 82 
sity of f ibroblast cytoplasma essentially increases in 24 h af ter t rans-
fection. It test if ies to the accumulat ion of β-galactosidase, a tested enzy-
me, in it (fig. 3, 4, 5). When us ing pGA293A and pCHHO construct ions 
a level of the luminous emit tance in cell cytoplasma is a lways higher both 
in 4 h and in 24 h in comparison with plasmid pGA293 [28, 29]. 
Quali tat ively similar pa t te rn is observed under comparat ive study of 
the bacterial β-galac tos idase content af ter t ransfect ion of f ibroblasts by 
p lasmids with IacZ gene under promoters of virus HbsAg of hepat i te 
B and earlier promoter SV40 [29, 30]. Cytoplasma of control cells 
(cells are t reated with «empty» liposomes) in 72 h af ter t ransfect ion has 
f ig s 3—9 o rd ina te axis — the number of cells wi th a def ini te in tens i ty of f luorescence; 
absciss axis — f luorescence in tens i ty of cells in re la t ive va lues ) . Peaks marked on the 
plot correspond to the l a rge s t quant i ty of cells wi th the given luminous emitence 
Fig. 5. Dis t r ibut ion of Ltk- cells by f luorescence intensi ty . In 72 h pos t t rans fec t ion : 
1 — t rea tment with «empty» l iposomes; 2, 3 — DNA plasmid pCHllO and pH$21 respe-
ctively in composit ion of l iposomes 
a weak glow, nuclei do not fluoresce. Distr ibution of f ibroblasts by fluo-
rescence intensi ty corresponds to the normal distr ibution (fig. 5). Cells 
fluoresced by plasmids pCHllO and pH$21 display another fluorescence 
pat tern . In 72 h af ter t ransfect ion one observes the appearance of fibro-
blas ts with vividly f luorescing cytoplasma in their population. When the 
curve of the test va r ian t distr ibution is broked down into components two 
main curve peaks corresponding to different fluorescence intensity are 
dis t inguished. The first peak appears to be nontransfected cells or the 
cells where IacZ gene does not manifes t itself by some reason. The se-
cond peak corresponds to intensively f luorescing cells. Bright specific 
f luorescence of their cytoplasma testif ies to an expression of gene by bac-
terial β-galactosidase . Pa t t e rn of the curves describing fluorescence in-
tensi ty of mice f ibroblasts t ransfected by plasmids pCHllO and pH$21; 
are noted to be similar . It evidences for about similar level of expression 
of E. coli gene under promoters HbsAg of hepati t is virus and en earl ier 
promoter of v i rus SV40 in mice fibroblasts. 
Stat is t ical processing is presented as data on a mean fluorescence 
intensi ty of cells depending on the type of the introduced DNA plasmids 
( sampl ing for each va r ian t is n = 60). Confidence limit of mean values 
and assurance of the boundary between control and test curves are de-
termined for the probabili ty n = 0.999: 
In tac t cells (17.93±0.714 
After t r ans fec t ion DNA of p lasmids : 
pCHllO 29.20 ± 1.38 
pH$21 31.55 ± 1 . 5 2 
Therefore, differences in fluorescence intensity of cells t ransfec ted 
by DNA of plasmids pCHllO and pH$21 are inconsiderable. However 
differences in glow, i. e. in the expression level of the studied gene are 
grea t in different cells of one population. 
72 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Nb 4 5 — 3-624 72 
Expression of model IacZ gene of E. coli in composition of vector 
molecules (plasmids pGA'293. pCMV\]) controlled by the earlier promoter 
SV40 as well as in plasmid рН\У2і under promoter of IIbsA,. Acpatit is 
virus B is carried out in a sequence of experiments with a pr imary cul-
ture of human and rat hepatocytes [31]. Transfect ion is performed by 
Ca-phosphate method. Expression product of bacterial β-galactos idase ;s 
tested in 4, 24 h, in 2 and 4 clays [32] . 
Transfect ion of the pr imary culture of ra t ' s hepatocytes by p lasmids 
pGA293A, pCM Vβ and ρΗβ21 is carried out in one experiment. Fixed 
cul ture of cells are stained s imultaneously by indirect IF method. So, 
Fig. 6. Trans iec t ion of the p r imary cul ture of ra t hepatocytes wi th p lasmids : a — 
pGA293A; b — pCMVfi; c — pH$21 (C — c o n t r o l ; 1-Х day; 2 — 2 days; 3 — 4 days 
a f te r t r ans fec t ion ) ; a — 2 davs af te r t ransfec t ion of human kera t inocytes bv p lasmids : 
1 — pGA293; 2 ~ pCMVfo C — control 
the obtained results are correctly comparable as to an expression level of 
each plasmid in a definite periods of time. Independent experiments con-
ducted in different time show that quant i ta t ive values (br ightness of lu-
minescence, percent of cells with identical luminous emittance) are usual-
ly somewhat different with the same plasmids and the cells of the same 
type. A level of expression and, thus, the quant i ty (in relative values) 
of the β-galactos idase enzyme developed by the cells is very convenient 
to t race for each par t icular plasmid in a day, two, four and so on under 
the used method for construction of plots. On the other hand it is possib-
le to compare these three plasmids by a level of β-galac tos idase expressi-
on in different periods. Proceeding from the presented plots (fig. 6, ay b) 
it is seen that β-galactos idase in case of hepatocytes is tested in a day 
in large quant i t ies of cells when us ing plasmids pGA293A and pH$21. 
In two days the most of all brightly f luorescing cells are observed in the 
var ian t with pH$21y the least of all — after t ransfect ion with plasmid 
ρ CM V β. In a case of plasmid pGA293A the quant i ty of the t ransformed 
cells is the lowerest. A similar result is obtained in tests on human kera-
tinocytes (fig. 6, d). The quant i ty of t h e ' t r a n s f o r m e d cells when us ing 
plasmid pGA293A in two days is smaller than with plasmid pCMVfj. On 
the 4th day from transfect ion the quant i ty of cells of a pr imary culture 
of ra t ' s liepatoeytes conta in ing bac.eriai β-galactos idase in the var iant 
ISSN 0233-7057. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Яв 4 7* № 
with pGA293A is almost the same as that af ter one day from transfect i-
on. in the var ian t with pCMV$ it falls to the level of control, in case of 
pH$21 it is about the level observed on the second day. However parti-
cu lar cells with bright ly f luorescing cytoplasma occur in culture thus 
ind ica t ing an increase of β-galactosidase content. 
We perform also independent experiments on determinat ion of IacZ 
gene expression by biochemical methods to support the results . Activity 
of bacterial β-galactos idase is determined by biochemical methods by the 
spl i t t ing efficiency of O-n i t rophenyl^-D-ga lac tos ide substrate . Activity of 
β-ga lac tos idase in L t k - cells is • determined on the third day after t rans-
fection. The results are presented in table 2. 
As is known eukaryotic cells have their own β-galactosidase activi-
ty. However, introduction of E. coli IacZ gene leads to a considerable in-
crease of a level of bacterial β-galactosidase in them. Expression effici-
ency of IacZ gene in composition of pH$21 plasmid is the same or so-
mewhat higher in L t k - cells t ransfected by pCHllO. It supports the data 
obtained by the cytochemical method (see fig. 5) . 
Determining β-galactos idase activity by the spl i t t ing efficiency of 
0 -n i t rophenyl^-Z)-ga lac tos ide we est imate a total activity of the given 
enzyme that is composed of the cell's own β-galactos idase activity and 
bacterial β-galactos idase introduced into the cell. 
It should be also taken into account that β-galactos idase gene due to 
the peculiari t ies of the initial plasmid s t ructures is not complete. It lacks 
a par t of the sequence from 3 ' end. That is why its enzymatic and anti-
genic activity does not quanti tat ively coincide. However quali tat ively the 
data obtained by IF method and by a direct analysis of the enzymatic ac-
tivity have the same tendency. 
Thus, tests on prepara t ions have shown that a theoretical prediction 
of the expression pat tern of gene in composition of different vectors when 
implanted into different types of cells proves unreliable. We may only 
say in the first approximation that (for the given systems) hepatocytes 
and kerat inocytes are better than fibroblasts. Besides it is evident that 
the cell population will be heterogeneous by the final effect — the expres-
sion of the implanted gene. Finally, there is no assurance that the regu-
lari t ies obtained on the cell cultures (i. e. outside the organ ism) will 
prove legi t imate even for the same cells in the organism. So, the second 
level of approximation (approaching human) may be only animals . It 
is necessary to est imate the expression pat tern of the implanted gene in 
cells within the organism. 
S e a r c h of a p p r o a c h e s t o f u n d a m e n t a l s o l u t i o n s 
o n m o d e l o b j e c t s i n v i v o . Consider ing the obtained data 
hepatocytes are chosen as cells-targets, while a direct injection of the re-
combinant molecules in the composition of liposomes as a system of ad-
minis t ra t ion [33, 34]. 
T a b l e 2 
Comparative study of β-galactosidase content in Lt k~-cells, 
transfected plasmid DNA containing IacZ gene under 
different promoters 
ρΝβ2/, M E / m l pHB320t M E / m l PCHliOt M E / m l 
C e l l s L t k - w i t -
hout p l a s m i d , 
M E / m l 
2.4 1.4 2.4 0.63 
3.5 2.2 3.5 0.72 
1.6 0.82 1.7 0.52 
2.4 1.18 2.5 0.318 
6.6 — 5.2 1.48 
6.4 2.4 4.8 1.6 
Aizfcm 
3 . 5 ± 0 . 5 2 1 . 6 ± 1.3 3 . 3 ± 0 . 5 0 . 8 7 ± 0 . 2 2 
7 і ISSN 0233-7657. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. Т. 9. Nb 4 5 — 3-624 12 
Liposomes as suppliers of plasmid DNA directly into the an imal ' s 
o rgan (liver, skin) are chosen because they facil i tate DNA conveyance 
into the cells and protect it from degradat ion (composition of liposomes 
and the method of their prepara t ion see in the section «Mater ia ls and 
methods») . Besides a direct injection into the t issue allows the mater ia l 
to be. delivered directly to cell membranes . In t ravenous adminis t ra t ion 
will inevitably calls forth the problem connected with a vessel barrier . 
Vessels of all levels including capil laries are ra ther an effective barr ier 
that 'prevents penetrat ion of many components through them. 
. The work with hepatocytes in vivo have engaged our at tent ion to the 
background glow of their eytoplasma (autoluminescence) in the green 
FitL;. 7. Aii tolumincscence of mice hepatocytes: 1 — intact animal ; 2, 3 — in 24 h af te r 
i 11 j (ч' t і (.) і ι of «empty;·· l iposomes and plasmid pGA293 with l iposomes into the liver 
Fi^ . 8. Distr ibut ion ol mice hepatocytes by the f luorescence intensi ty: 1 — intact ani-
mals ; 2--24 h af ter injection of p lasmids pGA293ZA and 3~-pGA293 in l iposomes into 
the liver 
spectrum where bacterial β-galactos idase is tested as a product of IacZ 
gene expression. It may distore the final results without consider ing the 
g i \ e n phenomenon. The results from measurements of hepatocyte's own 
luminescence (i. e. without any addit ional t rea tment) af ter adminis t ra t i -
on of pure liposomes and plasmid pGA293 into the liposome are presen-
ted. in fig. 7. 
Fluorescence of mouse hepatocytes from control groups (adminis t ra-
tion of nonloaded liposomes, physiological solution) in 4-24 h af ter injec-
tion is at a level of luminous emit tance in intact animals . A lowrer level 
oi eytoplasma fluorescence is also observed after injection of plasmid 
pGA293ZA (without IacZ gene) with a liposome. However in the latter 
case one observes an inconsiderable shift of the distribution curve maxi-
mum towards larger intensity of fluorescence writh a mark ing tendency to 
deviate from the normal distr ibution: par t of cells outside the Gauss ian 
curve possesses brighter fluorescence (fig. 8 , / , 2). Hepatocytes of ani-
mals whose liver is injected with plasmid pGA293 conta in ing IacZ gene 
display the largest shift of the maximum (among control va r ian t s ) on 
the distr ibution curve towards larger fluorescence intensity [33, 34]. 
In 24 h af ter adminis t ra t ion of plasmid pGA293 into the liposome 
one observes the appearance of cells with brightly f luorescing eytoplas-
ma in population of hepatocytes (fig. 8 , 2 ) . In one of the tests we break 
up the curve into the components. It allows reveal ing two main peaks 
cor responding to different fluorescence intensity (fig. 9, a ) . A group of 
cells with the brightest fluorescence makes up about 5 % of the total 
number. 
The first peak corresponding in its form to luminous emit tance dist-
ribution of hepatocytes in the control (intact animals and in the var ian t 
w-Iiii injection of DNA pGA293ZA to 75 % of cells) presents , apparent ly , 
either cells not at all t ransfected by plasmid or t r ans fec tan t s where plas-
mid is not expressed by some reason (fig. 9 y b ) . The second peak (about 
2 2 % ; of hepatocytes) accounts for the cells with bright specific fluores-
cence. The appearance of 5 % hepatocytes with the brightest luminous 
I S S r 023 :s r : r r Б И О П О Л И М Е Р Ы И К ЯCTKΑ. 1993. Т. 9. JVb 4 75 
emit tance may be at tr ibuted to the peculiarit ies of the metabolic s late of 
some liver cells that provides the most efficient expression oi IacZ gene 
(fig. 9, c). A control t rea tment of prepara t ion by nonspecific rabbit 's se-
rum testif ies to the absence of a specific fluorescence. Thus, a nons imi la r 
f luorescence of hepatocytes under adminis t ra t ion of plasmid pGA293 in-
to liposomes may be considered as a consequence of heterogeneity (cells 
by a level of synthesis in them) of bacterial β-galactosidase. 
The considered results may be presented also as data on a mean 
fluorescence intensity of hepatocytes (arbi t rary units) in 24 h depending 
on the type of the injected mater ia l ( sampl ing for each var iant is 220· 
Fig. 9. Example of the ana lys is of dis tr ibut ion curves by f Iuo res g low і-Uensity (24 h 
a f te r admin i s t ra t ion of plasmid pGA293 in H p ^ o u i e s ) . Explana t ion in the \c.xi 
cells) . Confidence limits of mean values and reliability of the difference 
of two peaks on the experimental curve are determined for Ihc- probabi-
lity ± 0 . 9 9 . Populat ion of cells with the brightest fluorescence is not pre-
sented here because of its small number. 
We have also experimental ly studied preservation time of IacZ gene 
expression products af ter introduction of a construction pGA293A into 
liposome. These experiments show thut the enzyme is continued to be 
tested in hepatocytes dur ing 8 days (fig. 10). Since the used plasmid 
does not in tegra te in gene the sequence alu is likely to perform here either 
p romot ing or enhanc ing funct ions that leads to a large accumulat ion of 
IaeZ gene product. However the quantity of brightly f luorescing hepatocy-
tes is noticeably lower than in a day a iter the injection. Fluorescence of 
the bulk of cells does not differ from Ihat when us ing plasmid pGA293ZΔ 
in composition of liposomes (fig. 10), i. e. with no β-galactosidase in them. 
Besides heterogeneity of cells one observes also individual differen-
ces on the o rgan i sm level by an expression criterion of Ibc introdu-
ced gene. 
A distinct individual reaction of mice on the injected materi a is is 
observed dur ing the experiment with animals . As a rule, about 50 % of 
an imals either do not react on the adminis t ra t ion of the plasmid mater ia l 
or there is a very weak expression of IaeZ gene in their hepatocytes. 
β -Galactos idase in the liver of other animals is tested in quant i t ies suf-
ficient to be tested by indirect IF method. The appearance of the indivi-
76 ISSN 0233-7657 Б И О П О Л И М Е Р Ы II КЛЕТКА. !993. Т. 9. № 4 
dual response in 8 days after injection is revealed more clearly than in 
experiments where the product is tested in a day or two. The quantity of 
animals with the expression product of IacZ gene detected in 8 days be-
comes ever smaller then the animals whose expression is observed in 
2 days. 
TIie presence of β-galactosidase in hepatocytes is also confirmed by 
other cytochemical method — sta ining of the cells by OHFG. The reaction 
product as small granules is distributed by the cell periphery in hepato-
cytes of intact animals. Smaller quantit ies are observed in the central 
part of cytoplasma. Heterogeneity of cells by β-galactosidase activity is 
Fig . 10. Distr ibut ion of mice hepatocytes by a f luorescence level in 24 h a iter injection 
in l iposomes !!ito the liver: 1 — pGA293Zh; 2 — pGA293; 3 — pCHllO; 4 — pGA293A. 
In 8 chiys a f te r admin is t ra t ion : 5 — pGA293A 
pronounced more distinctly in test var iants than in control one. Dense 
.accumulations of the expression product of β-galactosidase activity ap-
pear in the majori ty of cells closer to the cell periphery. Par t icular gra-
nules of the product locate near nuclei or freely in cytoplasma. Distribu-
tion of the product with enzymatic activity in some cells does not differ 
from that in hepatocytes of control animals. 
Somewhat different data are obtained when using vector on the base 
of hepatitis B virus DNA [30]. 
Studies of the IacZ gene expression in plasmid pH$21 and pCHllO 
adminis t ra ted into the liver of monthly mice have shown a tissue spe-
cificity of the vector obtained on the base of hepatitis B virus DNA. As 
in the above experiments the transfected hepatocytes have differently 
f luorescing cytoplasma and dark nuclei. The quantity of the t ransformed 
cells under the use of pH$21 plasmid in composition of liposome is in 
24 h after the injection much higher than in experiments with pCHllO. 
One is inclined to think that the presence of hepatitis B virus enhan-
cers in plasmid ρΗβ21 promotes an increase of IacZ gene expression in 
animals ' hepatocytes. Comparison of this gene expression in plasmid 
pHf)21 in culture of mice fibroblasts and in liver hepatocytes testifies to 
tissue-specificity of the hepatitis B virus enhancers. In animals this spe-
cificity manifests itself s tronger than in the cell preparations. 
! ,e · is convenient but not the only organ suitable for administra-
tion of recombinant molecules. A possibility to administer recombinant 
molecules intracutaneously is studied as an example. Piglets are taken 
as an object of investigation. 
ISSN 77 
Adminis t ra t ion of foreign genetic mater ia l in t racutaneously to 14-day 
piglets allows tes t ing bacterial β-galactos idase in the epithelial cells in 
a day af ter the injection. Nonloaded liposomes serve as a control to 
injection of plasmid pGA293A in composition of liposomes (fig. 11). Less t h a n 10 % of epi the l ium cells co r respond to the control v a r i a n t as to the 
glow intensity while the bright fluorescence of eytoplasma in the rest of 
the cells testifies to the presence of the bacterial β-galactosidase. Possibly 
so high efficiency of the t ransfect ion is connected with the age of animals . 
Therefore, expression of the implanted gene mater ia l is shown on the 
Fig. 12. Conten t of insul in- immunoreact ive proteins in the samples of cul ture medium 
in d i f ferent t e rms a f te r t r ans fec t ion of f ibroblast ceils in m a m m a l s (ordinate axis --
protein, mg /ml ; absciss axis — days) 
These works allow due to a possibility to es t imate expression of the mar-
ker gene in cells es tabl ishing a heterogeneity of cells by the studied sign 
as well as a character of this heterogeneity. Besides it is found out that 
heterogeneity is intrinsic in animals . It should be taken into account in 
the work. In fu ture it is necessary to design a test-system that allows es-
t ima t ing individual perceptibility of the organism to recombinant DNA. 
Such est imation must be followed by optimization of the adminis t ra t ion 
regime. 
Knowing general regular i t ies of the implanted gene manifes ta t ion 
and hav ing the developed system of adminis t ra t ion at hand we are com-
ing now to the study of a fundamenta l possibility of gene therapy of mass 
pathologies. 
As mass pathologies to study their par ry ing by the gene therapy we 
chose insul in-dependent diabetes melitus (IDDM) and atherosclerosis. 
Substantiation of fundamental possibility of gene therapy of irssuiin-
dependent diabetes melitus. IDDM is a boundary between classical here-
di tary diseases and classical mass pathologies. On the one hand such 
duali ty is explained by the fact that heredi tary component of IDDM appe-
arance is a l ready known though not in all cases but rather often. Moreo-
ver, it is formally monogenic in the sense that the disease is connected 
with an absence (or lack) of the product from only one gene — the one 
which codes insulin. It is formally monogenic because insulin is synthesi-
zed in the quant i ty necessary for the organism only in pancreas β-cells. 
Death of these cells leads usually to a lack of a total quanti ty of hormo-
ne. However the differentiat ion of β-cells, i. e. formation of cells synthe-
sizing insulin is under a very complex genetic control that is йен yet 
wholly identified and with many genes par t ic ipa t ing in it. On the other 
hand IDDM is really a mass pathology. 
In some rare cases this disease is classical hereditary, i. e. «from 
birth» and is connected with a genetic defect in the insulin gene. But in 
most cases it is induced by the insulin deficiency though the gene that 
78 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Nb 4 5 — 3-624 78 
codes insulin in all cells of the organism is not damaged. But r igorous 
t issue specificity of the expression blocks its activity even if the o rgan ism 
is agoniz ing because of its lack. 
According to some data diabetes takes the third place among the 
mortal i ty causes in the developed countries. Recently one observes growth 
of diabeties rate. IDDM makes up the bulk of such type of diseases. Un-
der juvenile diabetes one observes, as a rule, an early degrada t ion of 
β-cells producing insulin in the organism [35]. IDDM conditioned by the 
point muta t ions in a s t ructura l par t of the insulin gene [36]; proceeds 
phenotypically the same. 
In these cases pat ients are t reated by adminis t ra t ion of considerable 
doses of insulin obtained either by isolation of corresponding protein from 
the pancrease of mammals or by biotechnological methods. 
At the same time radical t rea tment , i. e. el imination of the causes 
of this disease may be provided only by gene therapy. In this case it is 
possible to administer insul in-producing cells in capsules or in some other 
way into the pat ient ' s o rganism or to implant a normal insulin gene in 
such molecular construction that provides its expression in pat ient ' s cells 
including nonspecialized cells. For development of new approaches to 
t rea tment it is important to study expression of the exogenic insulin ge-
ne in the isolated cells of mammal s in vitro and in cells from t issues 
in vivo. 
Insul in-coding gene is located in the eleventh chromosome in human 
[37]. It is established at present that regulat ion of the insulin gene ex-
pression is provided by 5 ' - f l ank ing region that included unique sequences 
and tandem repetit ions [38, 39]. It is this region that determines high 
tissue-specificitv of the expression (only β-cells of the pancreas ) . There-
fore for expression of the insulin gene in the cells where it does not work 
one usually uses a s t andard technique of connection of a s t ruc tura l part 
of this gene to some other regula tory sequence. This technique was used 
to demonst ra te expression of the human insulin gene in the cells of CV-I 
and COS lines [40, 41] when it was implanted into the cells with SV-40 
and Ad2 regulatory elements. 
In our work we solve the following problems: study of the expression 
of the genome gene of human insulin in composition of different molecu-
lar s t ructures, study of the peculiarities of its expression in the cultiva-
ted cells of different origin, development of the method for selection of 
cells t ransformed by the insulin gene and study of possibility to express 
the insulin gene in t issue cells under its direct implantat ion in liposomes 
into the organism of the experimental animals . 
A possibility of the expression of genome gene of human insulin from 
its own promoter in absence of the regulatory site providing tissue-speci-
ficity of the expression is studied in a detail in cultivated f ibroblasts of 
human and mouse. Results of twenty one independent experiments are 
described in previous works [42-44]. It should be noted that rather la rge 
var ia t ions in composition of the protein-product in the cul tural medium 
are observed in the experiments, though the experimental condit ions are 
thoroughly s tandardized. Such var ia t ions are at t r ibuted par t icular ly to 
f luctuat ions under formation of Ca-precipitate that is a def in ing functi-
on of the t ransfect ion level. It must be considered when us ing this method. 
However analysis of all the performed experiments allows t rac ing a dy-
namics of its secretion af ter adminis t ra t ion of recombinant pBR322ins 
plasmid into the cultivated cells. Since there is not noticeable difference 
in a dynamics of the product in case of human fibroblast LEH and mouse 
C3H10T1/2 [42]: the data are presented in one f igure (fig. 12). Concent-
ration of the tested protein (ng /ml ) of the cultural medium is shown in 
the ordinate axis, t ime after t ransfect ion of cells — in the absciss axis. 
In a day after adminis t ra t ion of the recombinant DNA into the cell 
system a level of the studied protein does not reliably differ from the 
control. Beginning from the 3d and up to the IOth day one observes a 
g radua l increase of the protein-product concentrat ion in the cultural me-
ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. № 4 6 - 3-624 7 9 
dium (pCO.OOl). On the 13th day a level of the protein secreted by the 
cells sharply decreases. On the 16th day and later a concentrat ion of the 
tested pi j . e in achieves 30-45 ng / in l . It must be noted that monoclonal 
antibodies selected by us for tes t ing recognize the determinant common 
for insulin and proinsulin and possibly for insulin-like growth factor evo-
lutionally approaching them. The f ibroblasts are known to produce insu-
lin-like growth factors in the process of normal reproduction therefore a 
relatively high background level in b inding of antibodies takes place in 
control samples. 
Expression of the genome insulin gene in the recombinant construc-
tion pBR322ins in f ibroblasts of four cell lines: LE И, SL, СЗН10ТІ /2 and 
L t k - are compared. It is shown that in all cases a maximal concentrat ion 
of the studied protein-product in the cultural medium amounts to 200-
250 m g / m l . Transfect ion of SL fibroblasts by DNA of recombinant pAins 
conta in ing a/i/-repetitions also resul ts in a secretion of a corresponding 
protein-product into the cultural medium. 
Concentra t ion of the protein-product under adminis t ra t ion of plasmid 
pBR322ins into cells of other types (embryonal mouse hepatocytes) amo-
unts to 120 n g / m l , i. e. twice as lower as in the above experiments. 
Cells of the human insulinome taken as a positive control produced 
into the medium 125 n g / m l of the protein-product under the same con-
ditions. The product of the studied protein is invest igated under conside-
rably increased level of the glucose concentrat ion (1800 rng %) as com-
pared with the normal (100 m g %) that may increase a t ranscr ipt ion and 
t rans la t ion regulat ion. In case of insulinome the produced protein is al-
most completely presented by insulin, that is apparent ly approaching the 
maximum which may be obtained in the culture of nonspecialized cells 
( insul inoma as all tumours consists mostly of dedifferentiated cells). 
To increase a level of synthesis we carry out a repeated t ransfect ion 
of three experimental prepara t ions of LEH under the same conditions as 
in the first t ransfect ion. Then the content of insulin-like protein factors 
in samples of the prepara t ions are compared af ter first and second t rans-
fection. In all three cases af ter the second t ransfect ion one observes a 
reliable increase of the protein-product as compared with the one obtained 
af te r s ingle t rea tment . If af ter the first t ransfect ion a maximal concent-
ration of the protein-product in the cultural medium is 140, 150 and 
250 n g / m l , then af ter the second — 800, 250 and 400 m g / m l , respective-
ly. There are essential individual differences in the protein-product bet-
ween three preparat ions , though one and the same DNA prepara t ion is 
used for t ransfect ion, the latter being carried out s imultaneously under 
the same conditions. The glucose content in one and the same samples is 
studied for est imation of the functional s ta te of the expression product 
of the insulin gene. Glucose concentrat ion in the samples of the cultu-
ral medium of the same prepara t ions (when the glucose consumption is 
insul in-dependent) is decreased by 370, 110 and 360 mg %, respectively 
in relation to the control level (table 3). 
T a b i c 3 
Maititenance of insulin and glucose in samples of cultural medium 
S a m p l e s 
T o t a l D i f f e r e n c e b e t w e e n t r e a t e d and u n t r e a t e d v a r i a n t s 
I n s u l i n , 
n g / m l G l u c o s e , mg % I n s u l i n , n g / m l G l u c o s e , m g % 
Untrea ted 
samples 30 1800 — — 
Trea ted samples : 
1 140 1490 110 —370 
2 150 1750 120 — 110 
3 250 1500 220 —360 
8 0 I S S N 0233-7657. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. Т. 9. Nb 4 5 — 3-624 80 
Therefore, the second t ransfect ion of the recombinant DNA pBR322ins 
ceils in human leads to an increase of the concentrat ion of the secreted 
protein-product. The secreted protein-product has a specific funct ional 
activity that results in a decrease of the glucose concentrat ion in the cul-
tural medium. An increase of the protein-product yield under repeated 
t ransfect ion is, on the one hand, connected with an increase of the insu-
lin gene dose, on the other — with a selection of most competent ceils 
from the general heterogeneous population by this index. As it is shown 
the used method of the immune-enzymic analysis does not allow deter-
min ing which protein exactly is secreted-insulin or proinsulin, i. e. whether 
the protein processing proceeds in the studied cells of the culture, it is 
known from li terature that only proinsulin is tested in cultivated cells 
ot the monkey's kidney CV-I conta ining the implanted insulin gene of 
human. There is no processing of proinsulin into insulin [40]. Proinsulin 
is known to possess a weak insulin-like action. We suppose that proinsu-
lin is obtained in our experiments, since the glucose content with its 
daily decrease does not achieve a normal level (100 m g % ) . It may be 
also assumed that a part of immune-reactive protein is evolutionallv si-
milar insulin-like growth factors produced by fibroblasts. The obtained 
results support the following conclusions. Gene of human insulin without 
its regulatory site responsible for tissue-specificity may function in the 
cult ivated f ibroblasts of different origin. When s tudying f ibroblasts in 
human and mouse one observes a similar time dependence of the protein-
product secretion of the insulin gene af ter implantat ion of the t rans form-
ing DNA. A level of the secreted protein is reliably increased as aga ins t 
control from 3d to 10 days and then it is sharply decreased. A maximal 
yield of the protein-product under one-time t ransfect ion is 200-250 m g / m l . 
Repeated introduction of gene increases the synthesis almost twice. A se-
creted protein is likely to be proinsulin that possesses a specific functio-
nal activity resul t ing in a decrease of the glucose concentrat ion in the 
cultural medium. 
A presence of a similar time dependence of the insulin gene protein-
product secretion for f ibroblasts of different origin testifies that such 
processes are not apparent ly species-specific. The next task of our work 
is to make an at tempt to select cells t ransformed by the insulin gene de-
void of a regula tor of the expression tissue-specificity. 
Klein's team has developed and evaluated the method of implantat ion 
and selection of the required hereditary information us ing cells from hu-
man and animal bone marrow for works on gene therapy [45]. This 
method is rather effective but as the same time it has evident drawbacks 
connected with a necessity to administer a toxic select ing agent and with 
a presence of a gene-assis tent that inevitably contaminates the genome, 
thus inducing side biological effects. 
We use another method for selection of the t ransformed cells. It is 
known that insul in-producing β cells are capable to fission. Insulin in 
combination with other growth factors and tumours promoters of TPA 
st imulates human and mouse f ibroblasts for fission [46]. Thus, the pre-
sence of cells producers of insulin a n d / o r proinsulin in the cell popula-
tion af ter t ransfect ion can possibly create a selective advan tage for growth 
and leads to enrichment of population with ce l l s - t ransformants under pas-
sage. An increase of survivabil i ty and improvement of growth propert ies 
may be par t icular ly pronounced in the medium depleted with serum or 
without serum. 
To verify this supposit ion we carry out t ransfect ion of LEH cells by 
means of DNA pBR322insy then inoculate them and cult ivate dur ing 10 
days (time of expression) in the growth medium with 10 % of embryonal 
serum. After this we replace the growth medium by the main tenance me-
dium with 3 % of the adult animal ' s serum and hold cells in these con-
ditions longer than 1 month (5 weeks) . It should be noted as aga ins t 
embryonal serum of catt le (60 n g / m l of insulin-like proteins) that se-
rum of adult an imals is depleted with growth factors (less than 1 n g / m l ) . 
ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. № 4 6 - 3-624 81 
From 30 to 60 n g / m l of insulin-like proteins are observed in samples of 
the cul tural medium dur ing the studied period. 
Then the cells are replated once a week to determine the protein-
product directly before each following passage . The results obtained un-
der determinat ion of the content of the protein-product of the insul in ge-
ne is subcul tures of LEH cells are presented in fig. 13. The content of 
protein af ter first and second passage exceeds 100 n g / m l . Fur ther one 
observes var ia t ions of the protein-product content in the samples of five 
studied subcul tures of human cells, but general ly a tendency to an in-
crease of protein secretion to the level of 200-250 n g / m l is traced (fig. 13). 
Fig. 13. The content of the protein-product in the samples of the cul tural medium under 
pa s sage of cell subcul tures (ordinate axis — ng /ml ; absciss axis — passage) 
Differences between experimental and control va r ian t s are in all cases 
reliable ( p < 0 . 0 0 1 ) . Comparison of the data from second and seventh 
pas sages reveals also reliable differences. There is an impression that the 
populat ion af ter cultivation is enriched with cells producing the studied 
protein in the medium poor in growth factors. If to compare the product 
of immunoreact ive protein in these experiments with the one produced by 
insul inoma (the data are presented above) it proves that the obtained 
culture is twice as effective as insul inoma. 
After the seventh passage the cells are cloned in the medium with 
20 % of embryonal serum [43, 47]. 
Efficiency of cloning of t ransfected cells is 1 %. This index is lower 
in control va r i an t s (0.001 %) . No clones are observed. Such low7 c loning 
efficiency is specified by the fact that cells dur ing several passages grow 
on half-selective medium and actually are depleted. But the depletion le-
vel in the control is so deep that cells do not grow at all af ter cloning 
while in the experiment due to the endogenic formation of insulin (or 
proinsul in) the cloning still proves possible. Five experimental clones are 
isolated, cells are reproduced, the content of protein-product is determined 
in samples of the cultural medium. An increased content of insulin-like 
proteins (60, 80 and 100 n g / m l ) is detected among those capable to clon-
ing is likely to be high. To make more exact quant i ta t ive analysis a great 
number of clones must be studied. 
8 2 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Nb 4 5 — 3-624 82 
Comparison of a total level of synthesis of the product recognized 
by antibodies to insulin in the culture af ter some passages under half-
selective conditions and clones isolates from this culture as seen from 
the above data and in fig. 13 shows a la rge quant i ta t ive difference. Al! 
clones prove essential ly less productive than the initial population. It 
suppor ts an in teres t ing supposition. If selection at a level of production 
proceeded under half-selective conditions then the insul in-producing clo-
nes would have a selective advan tage in cloning. Comparison of the clon-
ing efficiency points to it. But clones (all) isolate the immune-react ive 
product but in quant i t ies less than initial population from which they are 
produced. This is possible not for selection aimed at increas ing of the 
product level by cells but for the production proper of the given protein 
by the cells, i. e. for producing cells on the whole. However in this case 
one more assumption is needed — a regula tory one. A level of expression 
under g rowing conditions in half-selective media is higher than in ПОП*· 
selective ones optimal for cells. A maximal level of expression af ter clon-
ing (in 20 % serum) re turns to its low level corresponding to the one 
af ter the first t ransfect ion. This sugges t s that in the residual r ange of 
5 ' site of the insulin gene there are sequences that allow regulat ion of 
this gene in the nonspecialized cells. 
In two experiments where cells t ransformed by the human insulin 
gene are selected we use C3HLtk~ cells of a spontaneous tumour of mou-
se. The cells in this case are implanted with a restriction DNA f ragment 
with the insulin gene. In 10 days af ter t ransfect ion (expression time) 
cells are held in the medium without serum dur ing 1 month. Cloning ef-
ficiency of cells af ter long-term cultivation in the serum-free medium is 
less than 0.001 % in the control var iant , while af ter t rea tment it amounts 
2.2 %. Two experimental clones are isolated and reproduced. Insulin-like 
protein-product in concentrat ion 70 and 100 ng, respectively is found in 
samples of the cultural medium of these two clones. Dot-hybridization re-
veals the presence of addit ional copies of the insulin gene in DNA from 
cells of these clones. A difference displays itself only under their culti-
vation in the serum-free medium af ter t ransfect ion. Data on cloning of 
C3HLtk~ cells af ter their passage in the growth medium with 10 % se-
rum of cattle may be taken for comparison. Cloning efficiency in the 
control var ian t amounts to 13 %, in the experimental v a r i a n t — 16 % (a 
difference is not rel iable). 
Thus the presence and funct ioning of genome human insulin gene 
of exogenic origin in f ibroblasts of mammal s leads to an increase of cell 
survivabil i ty that is expressed under conditions of medium depleted with 
growth factors (for normal f ibroblasts of human and mouse) and medium 
without growth factors (for tumour cells of mouse) . This approach may 
prove helpful for enrichment of population with ce l l s - t ransformants and 
for selection of cells t ransformed not only by the insulin gene but also 
by genes of other growth factors. It permits doing without the gene-as-
sistent and a toxic agent . However it br ings up the problem on a possi-
bility of the accompanying selection of cells with s igns of ma l ignan t 
t ransformat ion . 
As applied to the problems of gene therapy a key moment here is the 
main tenance of the normal potential of division in order the cells when 
cultivated outside the organism do not acquire propert ies of the malig-
nant phenotype. In this connection we study a possibility of the t r ans -
formation foci appearance on the monolayer of the t ransfected cell cul-
tures of LEH and C3H10T1/2. However, t ransformat ion foci cons i s t ing 
of morphologically varied and chaotically located cells are not found. 
Cells C3H10T1/2 t ransfected by DNA of plasmid pBR322ins and initial 
plasmid pBR322 are also studied for their tumour forming ability under 
their subcutaneous adminis t ra t ion to new-born irradiated mice of a syn-
genic line. No tumours are found. Therefore implantat ion of the recombi-
nant DNA. with human insulin gene into normal cells with their subse-
quent selection on media depleted with growth factors does not lead to 
ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. № 4 6 - 3-624 83 
this mal ionization (at least within the sensitivity of the used 
methods) . 
Thus, the experiments on the eulture of cells have shown efficiency 
of the insulin gene expression under consti tutive promoters. Now it is 
necessary to est imate a fundamenta l possibility of pa r ry ing I D D M by 
implanta t ion of the insulin gene at a level of an experimental animal 
[48 ,49 ] . 
After implantat ion of plasmid pAins to animals with artificially in-
duced streptosotocine diabetes one observes in the great major i ty of mice 
a considerable decrease of the glycemia with its maximal fall in 6 h af-
ter injection. Then a g radua l increase of the glucose content lakes place 
but in 10 h its level is low as aga ins t control" and initial levels. Only in 
24 h af ter DNA implantat ion the initial indices are set again . A degree 
of the animal ' s reaction is different . In some speciments we observe a 
decrease of the glucose content to a moderate glycemia (7.5-5 mmol/1) , 
'in some others — to the norm (4.5-5.0 mmol/1) , still in others — to hyper-
glycemia (2.0-2.5 mmol/1) . Some experimental an imals died in 6 and 
10 h (4 mice). There are also animals with diabetes (9 %) that do not 
response to the adminis t ra t ion of the preparat ion (tabl. 4) . 
We perform some control tests to confirm a decrease of the glucose 
level under the influence of implantat ion of a plasmid with an active сте-
пе human insulin. Under the same conditions we inject' empty liposomes 
and physiological solution into the liver. It proves that opening of the 
peri toneal cavity before the injection and adminis t ra t ion of the physiolo-
gical solution do not essentially affect the glycemia dynamics. Injection 
of empty liposomes causes a decrease of the glucose content in the blood 
of ill animals , but it is less pronounced as aga ins t the action of pAins. 
Time is also different: a maximal decrease of the glucose content is ob-
served in 10 h af ter the injection. There are neither losses of animals nor 
hyperglycemia in this case. 
Thus, the implanta t ion effect of the plasmid car ry ing an active in-
sulin gene of human is analogous to the action of exogenic insulin pre-
para t ions injected to ill animals , i. e. one observes a considerable decrea-
se of the glucose content as aga ins t control in 6 h af ter the injection. 
A high individual variabil i ty of the animal ' s response to the action en-
gaged our at tention. It is typical that this variabil i ty takes place under 
inject ion of pure insulin. A reactive insulin and C-peptide in the blood 
serum of animals are compared af ter implantat ion of the recombinant 
DNA to them dur ing a maximal decrease of glucose (tabl. 5). 
The measurements have shown that the content of immunoreact ive 
insulin in animals of control va r ian t s is very close (differences are within 
the measurement er ror) . As for the animals from the experimental group 
they have more than a 4-fold difference in the quanti ty of the determined 
insul in while its absolute quant i ty under maximal values exceeds 2.5 ti-
Glycemia dynamics in mice with artificially induced streptosotocine diabetes after administratio 
T a b l e 4 
W h a t is a d m i n i s t e r e d W a y of a d m i n i s t e r e d The n u m b e r of a n i m a l s 
•Liposomes wi thout DNA 
Physio logica l solut ion 
Noth ing 
Insul in 
ρ Ains 
pGins 
Into liver 
In t raper i toneal 
Into liver 
Into liver 
( In tact sick animals ) 
In t r amuscu la r 
32 
4 10 
15 
7 
33 
* ρ > 0 . 9 9 ; ** ρ > 0 . 9 9 9 . 
84 I S S N 0233-7657. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. Т. 9. Nb 4 5 — 3-624 84 
mes a maximal level of control var iants , it corresponds to the insulin 
content in healthy animals . No C-peptide is observed in the bloods serum 
of experimental animals . 
As is shown the implantat ion of the model gene displays a high he-
terogeneity of animals as to susceptibility to this procedure. There are 
individuals with a high registered level of β-galactos idase expression in 
a hepatocyte and there are animals with this index di f fer ing from the 
control but slightly. So var iat ion in the level of the determined insulin in 
T a b l e 5 
Levels of IRI in 6—8 h CiJier injection* 
of ρ Ains into і he liver of rcits with 
artificially induced diabetes 
W h a t i s i n j e c t e d 
T h e n u m -
ber of a n i -
m a l s 
L i m i t s of 
I R I , M E / m l 
pAins 4 8.20—34.5 
Physiological 
solut ion 2 12.8—13.9 
In tac t sick 
an imals 3 10.3—13.8 
the experimental an imals proves 
expected, i. e. it wholly corre-
sponds to the regular i t ies es-
tablished in the experiments 
with a marker gene. 
The other plasmid pGins 
injected i n t r a p e r i t o n e a l ^ in the 
same doses in liposomes also 
causes a considerable decrease 
of the glucose level in ra t s 
the action of plasmid pGins with artificially induced diabetes. Thus, 
is ana logous to the action of pAins despite of the differences in the struc-
ture of vector molecules and injection methods (table 4) . 
We study the effect of the recombinant plasmid pAins on healthy 
Wis tar rats . An observed decrease of the glucose level in healthy an imals 
is also different. In some animals it is as in the control, in others — falls 
about twice. It should be rioted that in the control group (as well as in 
the experiments at the moment of injection) there are no essential devi-
aions from the average level. A relatively small decrease of the glucose 
content in rals. susceptible to the administrat ion of the recombinan' mo-' 
of pAins and pGins plasmids 
85 I S S N 0233-7657. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. Т. 9. Nb 4 5 — 3-624 82 
Iecules may be at t r ibuted to the powerful system of regulation of the glu-
cose content in the blood of healthy animals (table 6). 
Analys ing the obtained results one should consider also possible 
nonspecific reaction of the organism. It is known that the largest popu-
lat ions of macrophages (called also Kupffer cells of the liver) are loca-
ted in the liver and in the peritoneal cavity. They are the first Wnk 
of the protective system in the mammals organism. These ceils pop illa-
tions are heterogeneous as to their functional specialization — a set 
of receptors, s t ages of differentiat ion etc. Liposomes are easily and 
quickly phagocytized by macrophages . A high activity of the penthose-
phosphate path for glucose consumption is typical for activated macro-
phages [50, 51]. 
It is not the main way of glucose metabolism in the mammals . Its 
quant i ty depends on the funct ional s ta te and may be rather high when the 
cell t r ans fo rm all its biological activity on biosynthesis and isolation of 
purposeful products: mediators , enzymes. Glucose consumption by the 
Kupffer cells increases in this case 3-4 times. It affects this way or the 
other a total content of glucose in blood. Consider ing a total quant i ty of 
the Kupffer cells, a level of their activation, dynamics of glucose con-
sumption, its total initial level, a total quant i ty of glucose at the begin-
n ing of the experiment and in its peak activity and time necessary for it, 
difference in time with an action of insulin (a small lag necessary for 
penetra t ion and expression s ta r t of the gene) , var ia t ions in animals sus-
ceptibility to insulin and the implanted gene etc., a nonspecific action of 
the glucose absorption well accounts for the action of empty liposomes. 
An effect of the administered Insulin gene of human is well pronounced 
aga ins t the background of this nonspecific decrease of the glucose level 
in the control. 
Coincidence of the glucose absorption dynamics under adminis t ra t i -
on of pure insulin gene into the liver of ill animals allows a supposit ion 
tha t t rans i tory t ransformed hepatocytes isolate not proinsulin but insu-
lin [49]. Since for hepatocytes a correct level of proinsulin process ing 
and its t ranspor t from cells prove incredible we assume that a succession 
of s t ages for insulin matura t ion is changed. It is as follows: af ter proin-
sulin synthesis there proceeds a correct laying, then C-peptide is splitted 
off and finally the form not at all formed in β-cells (tentatively il may 
be called preinsulin: correctly set Л-peptide chains without C-peptide but 
with prepeptide) is isolated due to prepeptide through an internal cell 
membrane where it is removed while a funct ional ly active insulin comes 
into the intercellular space [1] . Under this t ranspor t C-peptide does not 
at all leave the cell (fig. 14). 
Expression peculiarit ies of the insulin gene implanted into the cells 
of the culture as well as cloning of these cells and a level of the tested 
product af ter the expression underlies a supposit ion that the f r agment of 
the genome under considerat ion contains certain regulatory sequences 
which allow for the regulat ion in the nonspecialized cells. Fig. 15 presents 
T a b l e G 
Administration of plasmid pAins arid pGins to haalthy animals 
W h a t is a d m i n i s t r a t i o n W a y of a d m i n i s t r a t i o n 
The number 
of a n i m a l s 
pAins 
pGins 
L i p o s o m e s 
P h y s i o l o g i c a l so lu t ion 
N o t h i n g 
»—•» 
In to l iver 
I n t r a p e r i t o n e a l 
I n t r a p e r i t o n e a l 
In to liver 
I n t r a p e r i t o n e a l 
( I n t a c t sick a n i m a l s ) 
11 
5 
5 
5 3 
G 
24 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. Т. 9. .Ν1·· ·ί 
a pr imary sequence of the insulin gene and ad jacen t regions from 5 ' and 
3 ' end. The cloned f r agment under considerat ion (in all above experi-
ments) is located between BglII and TaqI sites (sequences 2017-2022 and 
4819-4824). 
Comparison of the thoroughly studied s t ructure of the regulatory si-
tes of insulin 1 ra t ' s gene shows that a sequence in position 217-197 cri-
tical for t issue-specificity is absent in our construct ions ( B g l I I site begins 
from the nucleotide in position 167). 
Another negat ively (for others except β-cells) control l ing element is 
between 100 and 91 nucleotides. It is present in our construct ions. Howe-
ver due to sequence 110-100 that specifies b inding of a t issue-specific fac-
tor s t a r t ing the t ranscr ipt ion the expression of this f r agmen t conta in ing 
the insulin gene takes place in the cells that do not synthesize insulin in 
the norm [52, 53]. Canonical promoter sequences TATAAA-box (nucleo-
tides in position 28-24) are also preserved in this f ragment . CAP-site 
(o-position) is not disturbed as well. It allows va ry ing a level of expres-
sion in different types of cells. It is very s ignif icant that such residual 
regula tory elements may essential ly affect the expression in cells of dif-
ferent individuals in whose organism a level of synthesis of certain pro-
teins or their aff ini ty to the given sites are somewhat changed. In the 
norm insulin is synthesized only in β-cells of the pancrease (and in some 
nerve ones) . Therefore the insulin gene sites recognized by the tissue-
specific factors in t ranscr ipt ion of other cells are intended not for it. They 
are simply close to the insulin sites because of an accidental coincidence 
(a sequence is very shor t ) . 
Other not yet found regula tory sequences af fect ing the expression in 
the specialized cells are also possible. In this case our at tention is enga-
ged by an exceedingly high sa tura t ion of 5' nont rans la ted region G — C 
with nucleotide pairs (G in s ignif icant f i lament) . They amount to 49.7 % 
in sequence 885-1044, 60.9 % — i n sequence 1380-1816. There is an abun-
dant region G — C — in 3 ' they amount to 51.5% in position 4011-4079. 
Such cluster deviation can hardly be caused by a random distr ibution in 
25 %. These regions from 5' end and from 3' end are nont rans la ted . Their 
role in the regula t ion sugges t s itselt. These G — C regions from 5 / end 
are taken away from the f r agmen t under analysis while from 3 ' end — 
are kept. A kind of asymmetry appears there. Possibly it contr ibutes into 
the specificity of the described expression. 
Substantiation of a fundamental possibility of gene therapy of athero-
sclerosis. Atherosclerosis is taken by us as the second example of mass 
pathology to be t reated by the methods of gene therapy. If in case of 
IDDM a choice of the gene with en expected therapeut ic effect is evident 
then in case of atherosclerosis at first glance it seems to be impossible. 
Atherosclerosis is a mult i factor pathology [54] with many different phy-
siological, biochemical and molecular processes contributed into it. 
Really one cannot expect the only one universal means for all cases. 
I iowever medical experience testif ies that among all the var ious react ions 
G l u c o s e , m m o l / l 
T i m e a f t e r p l a s m i d a d m i n i s t r a t i o n , h 
0 6 10 24 
4.0—5.1 (4.6) 2.7—4.3 (3.5) 3.3—4.6 (4.0) 4.0—5.7 (4.8) 
4.2—6.0 (5.0) 2.0—5.7 (3.8) 2.3—5.4 (3.6) 3.1—5.9 (4.8) 
4.5—6.0 (5.1) 2.7—5.0 (3.8) 3.1—5.6 (4.3) 4.2—5.7 (5.0) 
4.3—5.5 (6.0) 2.4—5.3 (3.7) 3.9—4.9 (4.5) 3.9—5.7 (4.7) 
4.4—5.1 (4.8) 3.9—4.7 (4.4) 4.1—5.4 (4.8) 4.3—5.1 (4.8) 
4.3—5.7 (5.0) 4.3—5.7 (5.2) 4.0—5.1 (4.9) 3.5—5.6 (4.7) 
I S S N 0233-7657. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. Т. 9. № 4 6 - 3-624 8 7 
CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCT-
ACCTTGGAGAGAGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGGCCTTCAAGGTCTCTGCCTCCCTC-
CAGCCACCCCACTACACGCTGCTGGGATCCTGGATCTCAGCTCCCTGGCCGACAACACTGGCAAACTCCTACTCATCCA-
CGAAGGCCCTCCTGGGCATGGTGGTCCTTCCCAGCCTGGCAGTCTGTTCCTCACACACCTTGTTAGTGCCCAGCCCCTG-
AGGTTGCAGCTGGGGGTGTCTCTGAAGGGCTGTGAGCCCCCAGGAAGCCCTGGGGAAGTGCCTGCCTTGCCTCCCCCCG-
GCCCTGCCAGCGCCTGGCTCTGCCCTCCTACCTGGGCTCCCCCCATCCAGCCTCCCTCCCTACACACTCCTCTCAAGGA-
GGCACCCATGTCCTCTCCAGCTGCCGGGCCTCAGAGCACTGTGGCGTCCTGGGGCAGCCACCGCATGTCCTGCTGTGGC-
ATGGCTCAGGGTGGAAAGGGCGGAAGGGAGGGGTCCTGCAGATAGCTGGTGCCCACTACCAAACCCGCTCGGGGCAGGA-
GAGCCAAAGGCTGGGTGTGTGCAGAGCGGCCCCGAGAGGTTCCGAGGCTGAGGCCAGGGTGGGACATAGGGATGCGAGG-
GGCCGGGGCACAGGATACTCCAACCTGCCTGCCCCCATGGTCTCATCCTCCTGCTTCTGGGACCTCCTGATCCTGCCCC-
TGGTGCTAAGAGGCAGGTAAGGGGCTGCAGGCAGCAGGGCTCGGAGCCCATGCCCCCTCACCATGGGTCAGGCTGGACC-
TCCAGGTGCCTGTTCTGGGGAGCTGGGAGGGCCGGAGGGGTGTACCCCAGGGGCTCAGCCCAGATGACACTATGGGGGT-
GATGGTGTCATGGGACCTGGNCAGGAGAGGGGAGATGGGCTCCCAGAAGAGGAGTGGGGGCTGAGAGGGTGCCTGGGGG-
GCCAGGACGGAGCTGGGCCAGTGCACAGCTTCCCACACCTGCCCACCCCCAGAGTCCTGCCGCCACCCCCAGATCACAC-
GGAAGATGAGGTCCGAGTGGCCTGCTGAGGACTTGCTGCTTGTCCCCAGGTCCCCAGGTCATGCCCTCCTTCTGCCACC-
CTGGGGAGCTGAGGGCCTCAGCTGGGGCTGCTGTCCTAAGGCAGGGTGGGAACTAGGCAGCCAGCAGGGAGGGGACCCC-
TCCCTCACTCCCACTCTCCCACCCCCACCACCTTGGCCCATCCATGGCGGCATCTTGGGCCATCCGGGACTGGGGACAG-
GGGTCCTGGGGACAGGGGTCCGGGGACAGGGTCCTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGG-
GGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCGGGGACAGGGGTGTGGGGACAGGGG-
TCTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCTGGGGACAGGGGTGTGGGGACAGGGGTCCTGGGGA-
'CAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCCTGGGGATAGGGGTG-
TGGGGACAGGGGTGTGGGGACAGGGGTCCCGGGGACAGGGGTGTGGGGACAGGGGTGTGGGGACAGGGGTCCTGGGGAC-
AGGGGTCTGAGGACAGGGGTGTGGGCACAGGGGTCCTGGGGACAGGGGTCCTGGGGACAGGGGTCCTGGGGACAGGGGT-
CTGGGGACAGCAGCGCAAAGAGCCCCGCCCTGCAGCCTCCAGCTCTCCTGGTCTAATGTGGAAAGTGGCCCAGGTGAGG-
GCTTTGCTCTCCTGGAGACATTTGCCCCCAGCTGTGAGCAGGGACAGGTCTGGCCACCGGGCCCCTGGTTAAGACTCTA-
ATGACCCGCTGGTCCTGAGGAAGAGGTGCTGACGACCAAGGAGATCTTCCCACAGACCCAGCACCAGGGAAATGGTCCG-
GAAATTGCAGCCTCAGCCCCCAGCCATCTGCCGACCCCCCCACCCCGCCCTAATGGGCCAGGCGGCAGGGGTTGACAGG-
TAGGGGAGATGGGCTCTGAGACTATAAAGCCAGCGGGGGCCCAGCAGCCCTCAGCCCTCCAGGACAGGCTGCATCAGAA-
GAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGTGGGCTCAGGGTTCCAGGGTGGCTGGACCCCAGGCCC-
CAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCT-
GGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCC-
CCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTG-
GTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGC-
AGGGTGAGCCAACCGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTCCCACCCAGCATGGGC-
AGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAA-
AAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAG-
AGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACC-
GCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCG-
AACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGCCTCACGGCAGCT-
CCATAGTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTG-
TGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGAC-
CCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTCACGACCTAGGGCTGGCGGGCAGGCGGGCACTGTG-
TCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGT-
GGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGT-
GGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCTGCAG-
GCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGCCCTGCTGTGCCGTCTGTGT-
GTCTTGGGGGCCCTGGGCCAAGCCCCACTTCCCGGCACTGTTGTGAGCCCCTCCCAGCTCTCTCCACGCTCTCTGGGTG-
CCCACAGGTGCCAACGCCGGCCAGGCCCAGCATGCAGTGGCTCTCCCCAAAGCGGCCATGCCTGTTGGCTGCCTGCTGC-
CCCCACCCTGTGGCTCAGGGTCCAGTATGGGAGCTTCGGGGGTCTCTGAGGGGCCAGGGATGGTGGGGCCACTGAGAAG-
TGACTTCTTGTTCAGTAGCTCTGGACTCTTGGAGTCCCCAGAGACCTTGTTCAGGAAAGGGAATGAGAACATTCCAGCA-
ATTTTCCCCCCACCTAGCCCTCCCAGGTTCTATTTTTAGAGTTATTTCTGATGGAGTCCCTGTGGAGGGAGGAGGCTGG-
GCTGAGGGAGGGGGT 
Fig. 15. Primary sequence of insulin gene and adjacent region from 5' and 3' end 
par t ic ipa t ing in the development of atherosclerosis there is a certain lead-
ing motive. 
In compliance with modern notions on a s ignif icance of lipid and Ii-
poproteid metabolism in development of atherosclerosis numerous clini-
cal and experimental measures on prophylaxis and t rea tment of this di-
sease are based on us ing means that decrease the lipid content in blood 
[55]. Alongside it is known that development of atherosclerosis is con-
nected not only with changes of lipid but also protein part of lipoprote-
ids — apoproteins. Apolipoprotein Al is the main component ( 7 0 % ) in 
the protein fract ion of high-density lipoproteids (HDLP) which can re-
gulate a level of cholesterin in blood and remove it from cells oi vessels. 
A signif icant ant ia therosclerogenic role of this fraction in lipoproteids is 
confirmed by numerous epidemiological studies showing that human in-
dividuals with a high level of ITDLP do not suffer atherosclerosis while 
8 8 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Nb 4 5 — 3-624 88 
shor tage of this fraction of lipoproteids correlate with a risk of cardio-
vascular pathologies. It determines new approaches to searching of rnt i -
atherosclerotic prepara t ions among substances affect ing H D L P synthesis. 
Proceeding from the above it seems promising in cases of increased 
level of eholesterin, changes in correlat ions of the lipoproteid fract ions 
and other the like dis turbances of lipid metabolism envolving develop-
ment of atherosclerosis to increases H D L P level by genotherapeut ic cor-
rection us ing a cloned human gene apoAl. 
Clone with positive reproducible s ignals under its probe hybridiza-
tion to human gene apoAl is obtained after screening of about 3 -Ю 5 re-
combinant phages from the l ibrary of human genes. DNA of the recom-
binant phage is produced in preparat ive quanti t ies with its spl i t t ing by 
different restr ictases and subsequent Sauthern blot-hybridization of DNA 
f r agmen t s separated by electrophoresis. 
PsiI f r agment (about 2.2 kb) of human DNA is subcloned in compo-
sition of a bacterial vector pUCIS in two orientat ions (plasmid pUClSapo 
and pUC18apo'). Mapping of the cloned human DNA f ragment us ing 
restriction endonucleases HindlIlt Р у п і ї , SacIIt Краї, XhoIf SmaIj TagI 
confirms identity in the length of the obtained restr ict ions f r agmen t s with 
those of human gene apoAl whose restriction map is shown in fig. 16. 
A pr imary s t ructure of PstI-HindIII f r agment of DNA from 5' end 
of the cloned gene is determined. No changes are observed in the nucleo-
tide composition as agains t previously described for human gene apoAl 
[56]. The presence of seven-member AT-rich sequence (ATAAATA) which 
is a part in the promoter region in the na tura l gene su r round ing is con-
firmed in the cloned DNA f ragment in position — 264-258 in relation to 
ATG codon. Scheme of human gene apoAl and sequences specifying its 
regulat ion are shown in fig. 17. As we see PstI f r agment contains incom-
plete promoter but some elements responsible for tissue-specificitv are 
ISSN 0233-7057. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Яв 4 7* № 
absent. So, when constructing DNA we proceed from the necessity to in-
troduce additional regulatory elements into its composition. 
It is known from literature that a/«-repetitions in human contain DNA 
sequences that may act as enhancer for RNA-polymerase II and as pro-
moter for R N A - p o l y m e r a s e III [57]. There fore to s tudy the express ion of 
the cloned gene we construct a recombinant plasmid pALlapo which is 
different from pUC18apo by the presence of the polylinker from one hu-
man а/м-repetition that is cloned by BamHI site and located in the 5" 
end of the gene. 
Recombinant plasmids are used to t ransform mice fibroblasts of L t k -
Iine which in 24 h are washed and poured with a serum-free medium but 
1 3 6 10 
Fig. 18. The content of human apoAl in the cul ture medium af te r t ransfec t ion of mice 
f ibroblas t s by d i f ferent p lasmids: 1 — pALl 2 — pUC18apo'; 3 — pUC18apo (o rd ina te 
axis — protein, ng /ml ; absciss axis — days) 
Fig . 19. C h a n g e of C h S - H D L P af te r admin i s t ra t ion of h u m a n apoAl to adul t rabbi ts 
with 2 % glucose. In some periods of time this glucose is replaced for 
fresh portions to perform immunoenzymic test ing of human apoAl in 
samples. 
At each s tage we obtain lisates from cells for parallel test ing of pro-
tein in them. The results of tes t ing are shown in fig. 18. 
No protein Al is found in cell lisates of human that evidences for 
its prevail ing secretion into the cultural medium. A maximal protein sec-
retion into the cultural medium (under conditions of our experiments) is 
observed in 3-6 and 6-10 days after administrat ion of plasmid DNA. In 
all cases dur ing 10 days one observes a reliable excess of the quanti ty of 
the tested protein over the control (cells without implanted plasmid DNA 
and cells with the implanted pUC18) after transfection of pALlapo. The 
quanti ty of the tested apoAl after transfection of pUC18apo and 
pUC18apo' (different gene orientation) reliably exceeds the control back-
ground on 3-6 and 6-10 days. However its quantity is much lower than 
in the var iant with pALlapo. As it is expected an expression level of the 
gene in the cell culture does not depend on its orientation in the bacterial 
vector and is everywhere low if to subtract the control background. It 
may be attr ibuted to the fact that not all the sequences of the promoter 
site are present in the cloned f ragment of human DNA. Introduction of 
one human alu-repetition into the recombinant molecular enhances the 
gene expression. To our mind, it happens due to restoration of the en-
hancing function of a tissue-specific character. It also demonstrates that 
alu-like scattered repetitions possess important properties worthy of at-
tention. On the one hand they contain sites capable to enhance expression 
of the genetic material . On the other hand, their use because of their high 
occurence in the human genome may increase a frequency of homologic 
recombination, thus promoting integration of foreign genetic material . 
These properties make a/w-repetitions very promising under construction 
of vectors. 
The next s tage is devoted to study of the expression of human gene 
Al under its administrat ion into experimental animals. For the first ti-
90 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Nb 4 5 — 3-624 82 
me the problem of gene therapy of age pathology is s tated and experi-
mental ly solved. 
H u m a n gene apoAl in plasmid pALlapo is implanted to experimen-
tal animals (adult and old rabbi ts ) . It is shown that irrespective of the 
animal ' s age one observes human protein apoAl in their blood. It is de-
tected by Immunoelectrophoresis in the agarose gel with a specific anti-
serum to this protein. Immunoprecipi ta t ion does not take place in the 
blood of control animals . The quant i ta t ive est imation of human apoAl 
detected in the blood p lasma of ra t s (un-
der s t andard human serum) demonst ra tes 
that its content in 24 h after gene implan-
tat ion var ies from 0.5 to 0.25 m g / l e n g t h 
in old rabbits and to 0.9654=0.30 mg/ length 
in adults . 
Fig. 20. C h a n g e of C h S - H D L P af te r adminis t ra t ion 
of human apoAl to old rabbi ts 
Changes in the content of Chs-HDLP are observed in blood of expe-
rimental rabbits in 18, 24 and 48 h. From data in fig. 19 we see that they 
differ in different animals . However one observes mainly a growth of 
Chs level of LP fraction. 
As early as in 18 h wre observe a pronounced change of Chs -HDLP 
content in experimental animals of both age groups. Changes in adul ts 
are more pronounced than in old animals. ITowever it is pronounced 
enough in the old specimens too. The like changes we observe in total 
eholesterin of the blood plasma in rabbits [55]. Such regular i ty is ob-
served also in a change of a per cent content of H D L P as aga ins t other 
f ract ions of LP (table 7) in adult animals . Changes in old an imals are 
observed only in 48 h. Analys ing the data it is necessary to take into ac-
count a well-pronounced individual response of animals to the gene im-
planta t ion (fig. 19 and 20). So, the average induces do not reflect the 
s i tuat ion on the whole. 
Changes of relative Chs-FIDLP concentrat ions and H D L P fract ion 
are within diurnal var ia t ions of these paramete rs in control an imals with 
adminis tered empty liposomes (Ki9 K2). Data on the gene expression in 
a cell culture do not a lways adequately reflect the processes proceeding 
at a level of intact organism. Consequently the expression of human gene 
cpoAl is very important under its direct implantat ion into animal ' s cells. 
T a h l e 7 
The content of different fractions of lipoproteids in blood of adult and old rabbits after 
implantation of human apoAl gene (relative concentration, %) 
A d u l t O l d 
C o n d i t i o n s of t h e 
e x p e r i m e n t L D I P V L D L P H D L P L D L P V L D L P H D L P 
Contro l 
( admin i s t ra t ion of l iposomes wi thou t generic mate r ia l ) 
M i t i a l l e v e l 3 5 . 4 + 1 . 5 2 4 . 6 ± 1 . 6 40.0 + 3.2 5 1 . 4 ± 3 . 5 19 .6+2.1 29.0 ± 1 . 8 
18 34.6 ± 1 . 7 2 5 . 0 ± 1.4 41 .4±2 .9 5 0 . 7 ± 4 . 1 2 1 . 0 ± 2 . 4 28.3 ± 1 . 6 
24 35.1 ± 2 . 1 24.7 ± 1.8 4 0 . 2 + 2 . 5 5 1 . 1 ± 3 . 7 19 .8±2.1 29.1 ± 1 . 4 
48 3 6 . 0 ± 1.8 25.8 ± 1.5 2 0 . 7 ± 2 . 4 29.0 ± 1 . 3 
Gene implan ta t ion 
Mitial level 3 3 . 2 ± 1.8 2 6 . 7 ± 1 . 9 40.1 ± 2 . 8 5 2 . 3 ± 2 . 0 2 1 . 0 ± 1 . 6 2 6 . 7 ± 2 . 1 
18 33.54=1.2 2 0 . 0 ± 1.5 4 6 . 5 ± 2 . 3 5 3 . 0 ± 3 . 4 2 2 . 1 + 3 . 4 4 . 2 9 ± 2 . 1 
24 3 3 . 6 ± 1.7 19.1 ± 1 . 3 47 .3±2 .1 51 .6±3 .1 2 3 . 0 ± 1 . 4 2 5 . 4 ± 2 . 7 
48 32.7 ± 1.3 22.3 ± 1.2 4 5 . 0 ± 2 . 3 4 7 . 4 ± 3 . 1 2 0 . 0 ± 1 . 6 3 2 . 6 ± 2 . 1 
N о ( e . 18 , 24, 48 — t ime in h a f te r gene implan ta t ion . 
I S S N 0233-7G57. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. J . 9. № 4 91 
A level of expression depends on the peculiarit ies of the construction of 
recombinant DNA containing- human gene apoAl (PstI f ragment ) and 
addit ional regulatory elements. So, we cannot show the expression of ge-
ne in plasmid pUC18apo and pUC18apo' because of either a very low 
level of the gene expression with a f ragment of its own promoter into 
the composition of molecular s t ructures (below the sensitivity of the de-
tection method) or impossibility of the expression due to t issue-specifi-
city of its regulat ion that is more probable. A f ragment of 5' non t rans la -
ted region of human gene apoAl (—256-41, fig. 17) performing a func-
tion of a liver enhancer in the na tura l nucleotide sur rounding of the gene 
is absent in composition of molecular construction. It is supported by 1.he-
fact that implantat ion of human gene apoAl in the molecular construc-
tion with human α/^-repetition into the animals results in the easily-tested 
human protein in the blood of experimental animals though these con-
struct ions slightly differ by a level of the gene expression in the cultu-
re. Alechanisms of changes in certain physiological parameters in the 
Idood of model animals (Chs-HDLP, HDLP) registered in this case need 
further investigation. However comparison of the absolute values of 
these deviations with a corresponding level in control animals (liposomes 
without implanted gene) permits a supposition that it is connected with 
an expression of the implanted human gene apoAl. Data obtained а і tor 
implantat ion of DNA pUC18apo and pUC 18apo' to the rabbits suppor t 
the above supposition, i. e. implantat ion of the gene in the construction 
that does not provide a certain level of its expression does not lead Io 
changes of lipid characteris t ics in the organism. Heterogeneous changes 
observed in the organism of animals dur ing injection of expressing vec-
tor molecules may be at tr ibuted to individual variabil i ty of і he animals 
to the given gene as well as in previous experiments with other genes 
The obtained data on the expression of human gene apoAl at a le-
vel of intact model animals show that a physiological effect of the pro-
tein secretion af ter the gene implantat ion is short-term with subsequent 
damping. Therefore long-term experiments to s imulate physiological piw-
cesses proceeding in the organism require fundamenta l ly new approaches 
for construction of the vector molecules. As is known, implantat ion of Hie 
given gene in the retrovector is a usual methodical solution. However 
retrovectors cause certain misgivings. The use of eukaryotic ARS-seqnen-
ce of DNA may be an al ternative, to our mind. 
To verify a possibility of this approach in principle we subclone р:ч^ 
viously cloned EcoRI f r agment of maize genome DNA that possesses. 
ARS-funct ion in 5. cerevisiae [59] and AT. tabacum [60]. The recombi-
nant plasmid is entitled ρ AAA (apo-alu-ARS). ARS is taken from lis 
plant that is evolutionary very far from mammals with the aim to avoid, 
if possible, recombination events because of homology. 
Ability of this molecular construction to be preserved in the cell cul-
ture is est imated by determining t ransformat ion frequency of competent 
E. coli cells of plasmid DNA isolated from cell culture in certain periods 
of time after t ransfect ion (table 8) and by hybridization analysis of the 
same plasmid DNA. DNA pUC18 or human gene apoAl are used as a 
probe. Analogous operat ions but without implantat ion of plasmid DNA 
are performed with control cells. 
The obtained data testify that plasmid pAAA with maize ARS-sequerr 
ee in a series of recombinant molecules conta in ing human gene про Λ/ is 
best of all preserved in the cell culture. In this case we observe a smooth 
descending of the number of E. coli t ransformat ion . If to suppose that 
this phenomenon is resulted from the replication of plasmid DNA in Ibe 
cell culture then a decrease of the number of t r ans fo rman t s in t ime may 
be at t r ibuted to a negat ive balance of the replication process and biode-
grada t ion of the implanted genetic material . A character of changes in 
the X-ray film exposure intensity under hybridization analysis is analogo-
us to the data obtained by comparison of t ransformat ion frequencies от 
different p lasmids isolated after t ransfect ion of mouse f ibroblasts . 
92 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. .Ν1·· ·ί 
Data obtained after passage of t ransfected mouse f ibroblasts on se-
rum-free medium may serve as an indirect subs tant ia t ion of at least abi-
lity of DNA pAAA to preserve better af ter L t k - t ransfect ion. Their abi-
lity to cult ivation decreases in the order the plasmids are presented in 
fig. 9, i. e. cells with implanted pUC18apo (weakly secret ing apoAl) die 
fas ter than the cells with implanted pALlapo while these in their turn 
die faster than those with implanted DNA pAAA. We may suppose that 
since apoA 1 is a cofactor of the enzyme lecitin: cholesterin: acyl transfe-
rase that is s ignif icant for cholesterin metabolism in a cell then under 
conditions of deficiency (serum-free diet) the ability to synthesize apoAl 
becomes for a cell a critical factor determining its survivabili ty. There-
fore those cells that synthesize more apoAl survive in the first turn, i. e. 
the cells with implanted DNA pAAA conta ining ARS sequence of DNA. 
it is well known that different kinds of laboratory an imals differ in 
their susceptibility to atherosclerosis. Rabbits belong to the group with 
easily induced atherosclerotic pathology. In contrast to them there arc 
an imals which practically do not suffer this disease. In this connection it 
appears interest ing to study the effect of human gene apoAl implantat ion 
on certain parameters of blood serum in ra ts as representat ives of the 
populat ion resistant to this disease [61]. 
Pre l iminary experiments have shown that implantat ion of human ge-
ne apoAl in plasmid pALlapo and ρ AAA makes it possible to test human 
protein Al reliably in 48 h in ra t ' s blood plasma only when us ing recom-
binant DNA conta ining ARS. Since there are no data tes t i fy ing to a pro-
bable replication of pAAA we suggest analogously with the cell culture 
that the given molecular construction is better preserved when implanted 
to the animals , so we choose it for our fur ther work. Blood for tests is 
taken on 2nd and 7th day af ter implantat ion of human gene apoAl. The 
experiment is performed with 36 adult and 39 old animals . 
DNA pAAA in a liposome is administered into the liver of adult and 
old rats. On the 2nd and 7th day the human protein apoAl is tested in 
animals blood with s imultaneous determination of certain lipid parame-
ters. Protein is detected on the second day. Its quanti ty in adul ts is 8-10, 
in old animals — 4-6 p g / m l . In seven days af ter gene implanta t ion we do 
not observe human protein apoAl in the blood of both adult and old ani-
mals . It is at tr ibuted to the fact that either ARS-sequence of DNA in a 
molecular construction is not effective enough for the given system of 
ceils or irrespective of the plasmid better preserved in the organism there 
proceeds a t ransi tory expression of human gene apoAl whose level (con-
s ider ing protein clearance) does not allow tes t ing apoAl in 7 days. The 
appearance of human apoAl in the blood serum is accompanied by a chan-
ge of concentrat ions of different types of LP, par t icular ly ITDLP, corre-
lat ions of H D L P 2 and H D L P 3 subclasses (table 9). 
T a b l e 8 
A level of E. coli transformation by plasmids isolated from transfected mouse 
fibroblasts of Ltk- line 
P l a s m i d 
T r a n s f o r m a t i o n f r e q u e n c y 
of Ε . col i pe r 1 μ £ of 
p l a s m i d DNA 
T r a n s f o r m a t i o n f r e q u e n c y of E. coli p l a s m i d 
DNA a f t e r t r a n s f e c t i o n of f i b r o b l a s t s 
In 3 days In 5 days 
pAAA ( 1 . 4 ± 0 . 2 ) - I O 5 651 + 19 4 5 5 ± 1 8 
pALlapo (2.1 ±0 .3 ) · IO5 2 1 5 + 1 4 5 5 ± 5 0 
pUC I Hcif) ог ( 3 . 0 ± 0 . 3 ) - I O 5 2 3 0 + 1 6 6 8 ± 8 0 
pUClH ( 4 . 0 ± 0 . 4 ) - I O 5 280 + 1 7 7 3 + 9 0 
N o t e . For t ransfec t ion of L t k - we take 20 μ £ of plasmid DNA for one bott le of cells 
, ( abou t 5 -Ю 5 of cells). The quant i ty of g rown E. coli t r a n s f o r m a n t s are presented in 
t e rms of all genetic mater ial isolated f rom f ibroblas ts . 
!SSN 02.Γ,-7υ57. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. Т. 9. № 4 
On the second day af ter implantat ion of the cloned human gene 
apoAl one t races a tendency of the H D L P content increase in the blood 
serum of ra t s especially noticeable in old animals. The quant i ty of H D L P 
increases in adult an imals by 20 %, in old ones — by 30 %. Since H D L P 
as well as other L P is determined by the protein quanti ty, so the obtained 
data support a supposit ion that H D L P increases both at the account of 
human apoAl formation and by st imulat ion of ra t ' s own H D L P synthesis 
due to implanta t ion of human gene apoAl. A considerable increase of 
V H D L P in adul ts (by 3 6 % ) and especially in old animals (by 5 2 % ) 
accounts in favour of the supposi t ion on the effect of human gene apoAl 
expression on LP synthesis in ra t ' s liver. 
Implanta t ion of apoAl gene leads not only to a total growth of 
ITDLP in the blood of animals but also to a change in the content and 
correlat ions of subclasses of the L P - H D L P 3 and HDLP 2 , these changes 
being different in old and adult animals . Implanta t ion of gene apoAl, 
into the ra t ' s liver causes a considerable increase of H D L P 2 in old ani-
mals only (by 44 %••), while the content of H D L P 3 grows almost similar-
ly both in old and adult ra ts (by 26 % and 24 %, respectively). As a re-
sult H D L P 2 / H D L P 3 ratio increases in old ra ts while in adult ones it 
adult ones it falls (by 13.8 % ) . 
As is known H D L P 3 is able to accept Chs from periphery cells and 
to t r ans fo rm into H D L P 2 in this case. H D L P 2 in its turn conveys the ex-
cess of Chs into the liver cells. Different changes in the content and sub-
fract ion of H D L P under conditions of human gene apoAl implanta t ion 
both in adult and old animals test ify to the age changes in cholesterin-
acceptor funct ion of ITDLP in the old age. 
Implanta t ion of human apoAl into ra ts changes not only the quan-
tity of H D L P but also their protein composition {62]. Under conditions 
of gene implanta t ion one observes in adult and old animals a noticeable 
tendency to an increase (by 18.2 and 30 %, respectively) of a relative 
content in a subclass of apoAl in H D L P 2 ( table 10). An increase in the 
content of this subtract ion is observed also in H D L P 3 but only in old 
animals . 
Shif ts in the protein composition of H D L P isolated from ra t ' s blood 
are accompanied by the pronounced changes in their lipid composition 
(table 11). The content of phospholipids and free Chs in H D L P isolated 
from the serum of old animals increases by 34 % and 69.5 %, respective-
ly. In this case we observe a distinct tendency to a decrease of Chs es-
ters content (by 1 8 . 4 % ) . However a total content of Chs -HDLP is not 
changed which testifies that there is no enhancement of the addi t ional 
synthesis of Chs under implantat ion of gene apoAl. 
Changes in lipid composition of H D L P under conditions of gene im-
planta t ion cause shif ts of corresponding indices in subclasses of H D L P 2 
and H D L P 3 ( table 11). In old ra ts under the human gene apoAl implan-
tat ion in H D L P 2 one observes a considerable growth (by 67.3 %) of the 
T a b l e 9 
Effcct of human gene apoAl implantation in a liver of intact rats on concentration 
of fraction of lipoproteids and subclasses of HDLP in blood serum of different age rats 
L i p o p r o t e i d s , m g of 
p r o t e i n per 1 ml 
of b lood 
6 - 8 і m o n t h s 2 6 - 28 m o n t h s 
C o n t r o l J E x p e r i m e n t Cont ro l E x p e r i m e n t 
I I D L P 
HDLPo 
H D L P 3 
L D L P 
V L D L P 
0.152 + 0.040 
0 .116+0 .004 
0.397 + 0.035 
0.073 ± 0 . 0 0 2 
0.073 ±0 .006 
0 .616±0.024** 
0.124 ±0 .006 
0.491 ±0 .020** 
0 .082±0.005 
0.099 ±0.004** 
0 .517+0 .026 
0 .124±0 .007 
0.393 ±0 .020 
0.079 ±0 .006 
0.102 ±0 .010* 
0.672 ±0 .032** 
0.179 ±0.009** 
0.494 ±0 .033** 
0.093 ± 0 . 0 1 0 
0 .155+0 .030 
* Sta t i s t ica l ly s ign i f ican t d i f ferences between adul t and old an imals ; ** d i f ferences 
between control and experiment ( p < 0 . 0 5 — 0 . 0 1 ) . 
94 I S S N 0233-7657. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. Т. 9. .Ν1·· ·ί 
content of phospholipids. A correlation between Chs f ract ions changes in 
favour of free Chs (its quant i ty increases by 29 % while the content of 
Chs esters decreases by 21.4 %) . As a result an F C h s / E C h s rat io grows 
considerably in old ra ts (by 60 %) . Taking into account a considerable in-
crease of the protein mass of H D L P 3 one may assume that the outf low 
of Chs from cells in H D L P 2 less enriched with Chs esters is enhanced in 
old ra t s under conditions of gene implantat ion. 
The obtained data test ify that the implanta t ion of human gene QpoAl 
into rat 's liver leads not only to an increase of H D L P in the blood of 
tested animals (hyper-alfa-l ipoproteidemy) in correlation of their subclas-
ses but also to a change of their protein and lipid composition. The re-
vealed shif ts are more pronounced in old animals . This result proves most 
unexpected. To give it an adequate interpretat ion one needs addi t ional 
studies. We may suppose as yet that the response of an imals to the im-
planted key gene controll ing the given processes differs greatly. Probab-
ly study to the molecular fundamen ta l s specifying such differences may 
have an independent s ignif icance in the measures aimed at t r ea t ing this 
disease. It should be noted that implantat ion of human gene apoAl to ex-
perimental animals a long with changes registered in the blood causes 
essential events in cells of other o rgans and tissues. One observes growth 
in the content and activity of cytochrome P-450 [63]. Its quant i ty growrs 
more considerably and intensively in adult animals than in old ones (by 
54 and 46 %, respectively). 
It may test ify in favour of the induction of the expression of genes 
in the monooxygenase system under these conditions. However it is not 
incenseivable that such changes in the intensity of macrosomal oxidation 
under conditions of gene implantat ion may be a reaction on an increase 
of the concentrat ion of Chs coming into the liver by means of HDLP. 
Therefore implanta t ion of human gene apoAl to ra t s resul ts in the 
expression on the implanted gene and the appearance of human apoAl 
in the blood of experimental animals . It is accompanied by an increase 
of ITDLP level expecially in the blood of old ra t s and of the content of 
human apoAl in them. In old animals the quant i ty of apoAl increase at 
T a b i c 10 
Efjecl of human gene apoAl implantation into the liver of intact rats on a protein 
spectrum of high-density lipoproteids in rats of different age 
R e l a t i o n to t h e t o t a l o p t i c a l d e n s i t y , % 
P r o t e i n т . т . · I O 3 
6—8 m o n t h s 26—28 m o n t h s 
H D L P 2 H D L P 3 H D L P 2 H D L P 3 
ароС 1.2.5 
с 1 3 1 3 
е 1 17 .6+1 .3 1 3 
CipoAl 
с 58 .2±3 .0 36.1 ± 4 . 7 2 0 . 0 ± 2 . 2 14 .0± 1.2 
е 6 8 . 8 ± 4 . 5 22.3 ± 4 . 8 26.1 ± 2 . 4 21.0 ± 2 . 3 
Arginin-r ich protein 35 
с 25 .3±3 .0* 10 .0±2 .3 4 0 . 8 ± 4 . 8 2 3 . 5 ± 3 . 2 
е 15.0 ± 3 . 2 2 3 . 4 ± 5 . 7 50.3 ± 6 . 1 29.1 ± 3 . 3 
apoAlIV 51 
с 8 . 8 ± 0 . 6 15 .9±2 .0 30.1 ± 2 . 2 13.4 ± 2.1 
е 8.1 ± 1.2 13 .3±0 .5 17 .8±1.2* 15.2 + 2.5 
apoAl 2 
с 6.1 =t 1.6 19 .0+4 .3 8 . 0 ± 2 . 7 4 2 . 2 ± 2 . 5 
е 8 . 3 ± 1.9 2 0 . 0 + 4 . 9 9 . 3 + 1 . 2 25 .1+4 .5* 
High-molecular proteins 80 
с 2 16 .1+3 .3 1 6.4 ± 1.1 
е 1 13 .3±3 .8 5.1 ± 1 . 0 7 . 2 ± 1.3 
* Sta t i s t ica l ly s ignif icant : d i f ferences in the exper iment (e) as a g a i n s t control (c) 
(p C 0.05). 
33 I S S N 0233-7657. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. Т. 9. .Ν1·· ·ί 
the account of its growth in the subfract ion of HDLP 3 . Other indices al-
so change. 
Suniming up the data of this section one should dis t inguish the fol-
lowing principle moments in the whole complex of shif ts af ter implanta-
tion of human cloned gene apoAl to experimental animals . First , these 
are changes connected with synthesis of human apoAl gene and its ap-
pearance in the o rgan i sm of experimental animals . Second, it is a com-
plex of gene regula tory shif ts (growth of VLDLP content, change in the 
correlat ion of apoproteins, change of the quali tat ive composition of LP) . 
Third, a g e n e r a l i z e d response of the cell (induction of the macrosomal 
oxidat ion) . Attention is engaged by the fact that synthesis of human 
apoAl in the o rgan ism of ra ts is more pronounced in adult an imals while 
gene-regulat ion shif ts — mainly in old ones. Apparent ly it is connected 
with the fact that the genome regulat ion in the age ing changes itself be-
ing a fundamenta l link in the age ing mechanisms [61]. Potential i ty of 
gene therapy to affect the age ing opens quali tat ively new prospects for 
t rea tment of what seems impossible — therapy of age pathologies, it ap-
pears in teres t ing that implant ing of a present gene for a corresponding-
system that ensures expression makes it possible to obtain the effect of 
enhancement of the processes which themselves do not promote develop-
ment of atherosclerosis in the given organism ( ra t ) . Such enhancement 
leads, to our mind, to elimination of eholesterin from a cell membrane, 
thus becoming more important as was previously assumed. 
Thus implanta t ion of gene Al has resulted in the expected physiolo-
gical effect which is expressed in an increase of Al protein and in all 
subsequent changes that are the consequence of such increase. Now it 
is necessary to find out a fundamenta l possibility of therapeut ic effect 
under the action of implanted gene Al. With this aim we use a commonly 
accepted model of cholesterinemy in rabbits caused by feeding them with 
food rich in eholesterin. After eholesterin load one observes a sharp in-
crease of the eholesterin content in the blood plasma of rabbits which 
then slowly decreases. Simultaneously the content of eholesterin grows 
due ίο high-density lipoproteids. 
T ab Ie 11 
Efjeci of human gene apoAl implantation into the liver of intact rats on lipid 
composition of HDLP and their subclasses in the blood serum of rats of different age 
L i p i d s , 
m m o l / m g 
cf p r o t e i n 
H D L P HDLP 3 HDLP 2 
C o n t r o l E x p e r i m e n t C o n t r o l E x p e r i m e n t C o n t r o l E x p e r i m e n t 
Phi 
TChs 
FChs 
EChs 
Piil 'TChs 
Phl / FChs 
FChs EChs 
PhI 
TChs 
FChs 
EChs 
P h l / T C h s 
Phl /FChs 
FChs/EChs 
0.97±0.08 
2.84 ±0 .09 
0 .58±0.03 
2 .26+0.12 
0 .34±0.02 
1.95 ±0 .14 0.26±0.02 
0.63±0.04* 
3.45+0.20* 
0 .46±0.06 
2.99 ±0 .26 
0.18±0.02 : ; 
1.59 + 0.10* 
0 .15±0.02 
0.82±0.06 
2.87±0.14 
0.50 + 0.039 
2.35 ±0 .09 
0.29 ±0.01 
1.86 + 0.21 
0.21 ±0 .02 
6—8 months 
1.03 ±0 .10 
1.94 ±0 .18 
0 .30±0.04 
2.10 ±0 .19 
0 .30±0.01 
2 .40±0.30 
0 .14+0.02 
0.45 ±0.05* 
2.05+0.21 
0.23 ±0 .02 
1.82±0.20 
0 .22±0.03 
1.92 + 0.34 
0 .13±0.02 
1.52 ±0.11 
3.51 ±0 .06 
0.5Й t().03 
2.90 ±0 .19 
0.43 ±0 .02 
2 .87±0.35 0.18 ±0.02 
1.61 ± 0 . 1 0 
3.79 ±0 .36 
0.33+0.04" · 
3.08 ±0 .32 
0.47 ±0.04 
4.83+0.49** 
0 .11+0 .03 
26—28 months 
0.85±0.08** 0 .90±0.09 0.56±0.07** 0.68 + 0.13* 1.13±0.15* : ; 
3.22±0.14 2 .58±0.29 2 .78±0.30 4.91 ±0.51 3 .94±0.40 
0.78±0.06** 0 .36±0.05 0 .40±0.03 0 .42±0 .05 0 .55±0 .03 
2 .44±0.14 2.65±0.27* 2 .37+0.28 4.25±0.54* 3.38+0.39** 
2.26±0.01** 0 .43±0.08 0.20±0.03** 0 .22±0.05* 0 .20±0.04 
1.62 + 0.21 2 .30±0.25 1.49±0.16** 1.62±0.35* 2 .05±0.29 
0.32±0.03** 0 .15±0.02 0 .17+0.01 0.10 + 0.01 0 .16+0.01 
* Statist ically s ignif icant differences between adult and old animals; ** differences 
between control and experiment (p<0.05—0.01) ; Phl — phospholipids; TChs — total 
eholesterin; FChs — free eholesterin; EChs — esterified eholesterin. 
96 I S S N 0233-7657. Б И О П О Л И М Е Р Ы И К Л Е Т К А . 1993. Т. 9. Nb 4 5 — 3-624 96 
Fall of a total cholesterin is accompanied by a fall of the I IDLP cho-
lesterin content (fig. 21). 
Implanta t ion of gene Al essentially changes the s i tuat ion. A total 
content of cholesterin in blood in a day af ter the end of the cholesterin 
load proves much lower than in the control (i. e. in the var ian t with cho-
lesterin load but without implanted gene Al). At the same time the 
Fig. 21. Ef fec t of t r ans fo rmed h u m a n gene apoAl on development of hypercholester i -
nemy in rabbi ts ( there and on the f ig. 22* — sta t i s t ica l ly s ign i f i can t compared to the 
init ial level; * * — t h e s a m e to cholesterol load) 
Fig. 22. Effect of t r a n s f o r m e d h u m a n gene apoAl on a the rogeny coefficient in rabbi ts : 
A — cholesterol load; B — the same af ter t r ans fe r of h u m a n apoAl gene) 
content of cholesterin in H D L P increases several times. Moreover it 
continues g rowing on the second day in contrast to the control when 
it fal ls (fig. 21). 
Atherogenic coefficient changes correspondingly: it grows in the con-
trol and fal ls in the experiment (fig. 22). 
Thus implantat ion of gene Al has led to a distinct therapeut ic effect. 
Discussion of the results. Along with anticipated results the expe-
r iments have brought about addit ional data that prove not only unexpec-
ted but also demanding fur ther explanat ions. The main integral result 
consists in a fundamenta l possibility to influence the process under ly ing 
mass pathologies by means of implantat ion of outside molecular construc-
tions with a corresponding gene. However this general conclusion some-
how conceal the peculiarit ies specifying the process. Let us dis t inguish 
and analyse them. 
First that s tands out is a low correlation of the results obtained in 
the culture outside the organism and in the animals , i. e. on the organism 
level. It has been expected this way or the other. However it should be 
emphasized once again as applied to gene therapy of mass pathologies 
Est imat ion of the recombinant p lasmids for the absence of random muta-
tion (in a broad sense of the notion) defects in them which are possible 
under assemblage of complex construction is real in the systems in vitro. 
Another general est imation of the processes us ing cul tures of cells such 
as tissue-specificity of regula tory elements, effects of subsequent t rans-
fections etc. is also possible. Cell cultures are far and away helpful in 
this regard . But fur ther extrapolat ions with them on the o rgan ism are 
not effective. 
The next group of phenomena may be character ised as an ambigui ty 
of the expression of the recombinant molecules. It mani fes ts in the fol-
lowing. On the one hand different molecular construct ions conta in ing 
one and the same gene under different promoter-enhancer systems even 
if they are not t issue-specific express differently in one and the same 
cells. On the other hand one and the same recombinant molecule (aga in 
if its gene is under nontissue-specific promoter-enhancer system) is dif-
ferently expressed in cells of different t issues. 
ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. JSfe 4 7 — 3-624 97 
Most likely it testifies to a conditionality of the term «nontissue-spe-
cificity» itself. Sueh nonspecificity is only of a qual i ta t ive character — 
the expression in all types of cells. Quant i ta t ive character is t ics of the 
expression are nevertheless tissue-specific — in some t issues the expression 
is higher, in some — lower. 
Then there follows a group of phenomena that may be called biolo-
gical heterogeneity of the expression. 
As is s tated above there is always a high degree of heterogeneity in 
cells by the expression of the implanted gene in different cells of one 
type (for example hepatocytes) in one organ (liver in this case) in one 
speciment (part icular experimental animal under one populat ion of iden-
tical recombinant molecules). Special s tudies have shown that at least 
for the liver such heterogeneity is not connected with a nonuniform 
distribution of the implanted mater ia l . In some dozen seconds it 
spreads uniformly over the organ. Moreover, the mater ia l from different 
liver sections has the same spread of expression as in the place of 
injection. 
Finally, even in the cultures of cells where the population is maxi-
mally levealed off both by the fussion s tage and spatial ly (monolayer) 
one observes the same heterogeneity of the expression in principle. 
Therefore we have to admit the presence of the individual cell hete-
rogeneity in the quant i ta t ive character is t ics of the expression of the gene 
implanted from outside both in the culture and (which is more important) 
in the organism. But heterogeneity by this criterion takes place in the 
o rgan i sm also — a quant i ta t ive character is t ics of the expression of the 
gene implanted to different o rgan isms (one species and one line) are al-
so different . It is here very essential that the character of the cell hete-
rogeneity, i. e. distr ibution curves (see section III) are different in dif-
ferent individuals . So, a long with a cell heterogeneity we observe also 
an individual o rgan ism heterogeneity with regard to the expression of 
the gene implanted from outside. 
The phenomenon in question seems to be exhausted by these two ty-
pes of heterogeneit ies. But the reality proves much broader . Age var ia-
bility in the level of expression is demonstra ted above. In its pure form, 
i. e. as an expression of only one implanted gene it decreases with age 
( though individual types of spread ing are present ) . Analysis of the chan-
ges in different metabolic chains induced by the implantat ion of one key 
gene has shown that there are processes which are more enhanced in the 
old organism than in the young one. 
That is why it is so necessary to take into account the age hetero-
geneity by the same criterion — expression of the implanted gene and 
processes associated with it. Besides experimentally established types of 
heterogeneity one may predict (postulate) the fourth type of heterogenei-
ty. It is specified by a physiological s ta te of the organism. Due to this 
type of heterogeneity a response of one and the same organism in one 
and the same age will change depending on its s ta te — s tage in the de-
velopment of the main disease, the presence of accompanying patholo-
gies, stress, nervous breakdown etc. 
Biological heterogeneity is, apparently, underlain by two phenomena. 
First , this is different competence of different cells. As a result recombi-
nant molecules penetrate not in all cells but if penetra te then in diffe-
rent quanti t ies . Second, in different cells even if the number of penetra-
ted recombinant molecules is the same it is hardly possible to expect 
their similar expression. It is well known that any organism's own gene 
is somewhat different by the level of its expression. Different cells display 
different total level in synthesis of DNA, protein etc. The exist ing diffe-
rences wholly depend on the state of the cells. But the s tate of the cells 
will be inevitably affected by the s tate of the organism, its individual 
peculiarit ies, age etc. State of the cells will affect their competence. All 
these factors specify biological heterogeneity of the expression under im-
planta t ion of recombinant molecules in vivo. 
9 8 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Nb 4 5 — 3-624 98 
All the above stated evidence for the necessity to individualize gene 
therapy of mass pathologies. Biological heterogeneity this way or the 
other should be taken into account under classical heredi tary diseases. 
Biological heterogeneity in view of many metabolic chains that are being 
envolved into the process prove damaged becomes def ining in many res-
pects. So, it demands development of special methods for est imation of 
such heterogeneity and subsequent t rea tment with regard for the testing-
results . Each man prefers his own molecular construction optimal for 
him only though it may have one and the same key gene. Different im-
planta t ion systems are necessary for different people. The quant i ty of 
recombinant molecules for different people are also different. 
Individual izat ion of gene therapy is a new problem not yet stated. 
The sooner its development will s tar t the better. 
A system of gene implanta t ion should be treated with great care 
If the gene is implanted only once it will be modified by the above sta-
ted phenomena. However gene therapy of mass pathologies will require 
frequently (if not in most cases) repeated implanta t ions [1, 64]. Jn this 
case one may expect surprises. As it was stated above even under t ran-
sitory expression (determined by the vector construct ion) under repeated 
gene implanta t ion one may expect not wave but additive effect. Though 
such si tuat ion is observed only in cell cultures, but two moments of the 
experiments sugges t the idea that this is possible in the organism. 
First , repeated implanta t ion of gene has also revealed a biological 
heterogeneity not on the distr ibution curve but at a level of different, 
subpopulat ions. 
Second, this effect is observed only when the cultures are implanted, 
under half-selective conditions, but these are peculiari t ies of their physi-
cal s tate. Possibly, in some individuals due to their specific physiologi-
cal s ta te this s i tuat ion may arise in the organism. Further experiments 
will permit ref ining this supposition. 
The idea of a «key» gene that should exist even in diseases envolving 
different physiological, biochemical and molecular processes and thus 
not several genes but numerous gene ensembles is a fundamenta l ele-
ment of gene therapy of mass pathologies and it should be practically 
confirmed. 
Strictly speaking, even under classically monogenic diseases a de-
fect of only one gene inevitably causes dis turbances of many physiologi-
cal, biochemical and molecular processes and, thus funct ioning of gene 
ensembles that is general ly accepted. It is enough to see what is going 
on in the organism under tellasemy, classical heredi tary diabetes, hyper-
cholesteremy specified by the defect of either s t ructural or regulatory zo-
ne of gene apoAl, etc. In this case a key role of one gene in the distur-
bances involving the whole organism is evident. But in case we do not 
know that atherosclerosis is caused by the defect of gene apoAl its role 
seems to us dubious. Then it is obligatory to find a really defected gene 
and at t r ibute everything to it. But it would be valid only if the processes 
in the organism are independent . But they are not only dependent but 
also ranged by a degree of defect compensation. Something may compen-
sate only itself, something — the whole process, and something all its 
«hierarchy» of processes. Otherwise organism cannot exist-defect of any 
gene would lead to its death. So the main problem is reduced to f inding 
of such key gene which would compensate its hierarchy of the processes. 
For IDDAl it is insulin gene (even if it is not genetically damaged under 
IDDM); for atherosclerosis it is Al though not in all cases of this patho-
logy. Development of gene therapy of mass pathologies will undoubtedly 
give rise to studies on f inding «key» gene for this disease. 
Amalysis of the above described gene apoAl implantat ion has reve-
aled an obvious quant i ta t ive discrepancy of the human protein Al synthe-
sized in the animal ' s organism and the response of other metabolic cha-
ins on it. This discrepancy is most evident if to compare the quant i ty of 
the tested human Al protein and an increase of the quant i fy of lipoprote-
ISSN 0233-7057. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Яв 4 7 * № 
ids conta ining a total protein Al in experimental animals with regard 
to control. The content of protein Al in rabbits (on the example of Japa-
neese white rabbit) amounts to about 37 mg per 1 kg of the animal ' s 
weight [65], while synthesis of human Al af ter implantat ion of a corres-
ponding gene amounts to unities of p g per 1 ml of blood, і. e. і s і m її 
per 1 kg of the animals we igh t . ' I t is less than 3 % of animal ' s own pro-
tein. Increase of lipoproteids conta in ing protein Al is some dozed 
percents. 
A simple extrapolat ion of a level of Al synthesis on the base of the 
•implanted gene on all the processes caused by this synthesis cannot ex-
plain the si tuat ion. However medicine has accumulated much information 
about discrepancies of this type. In view of the evident effect induced 
by adminis t ra t ion of ATP, cocarboxylase, phospholipids («liposta-
b i b , «essentiale» drugs, etc.) the quant i ty of the administered prepara-
tions is only thousandth f ract ions of the quanti ty always normally pre-
sent in the pat ient ' s o rganism. And clearance of such prepara t ions is only 
some minutes. Dose disperancy cannot be adequately explained by for-
mat ion of some specially active biological derivatives from the admini-
stered prepara t ions . Since the quant i ty of the same products of orga-
nism's own origin is hundreds (and even thousands times) more than 
the adminis tered ones, so a corresponding quant i ty of derivatives forms 
in this case. Evidently there should exist some addit ional explanat ion. 
Here we may admit a new type of regulat ion. The regulat ion that acco-
unts for almost all effective events in the organism is based on the prin-
ciples of the feedback with an oposite sign, if the quanti ty of the pro-
ducts increases the regulat ion decreases its synthesis, the quanti ty falls, 
the synthesis is enhanced. For the most of proteins there is a base con-
st i tut ive synthesis that is permanent and is not subject to regulat ion, it 
is likely to be valid for metabolic processes. But the organism is the most 
complex t ang le of corre la t ing processes and their dis turbance is a po-
werful destructive factor for the organism [66]. Fluctuat ions both outsi-
de and inside the organism cannot but lead to temporal cha nge oi Uiese 
or other processes. All this causes a quant i ta t ive disbalance — a discre-
pancy of mass and energy flows between metabolic chains. The first sta-
ge for compensat ion of such disbalance is well known: it is reverse enzy-
me capacit ies. A par t of enzymes is in its nonactive s ta te and el iminates 
a disbalance of mass and energy flows either at the account of confor-
mation t rans i t ions ( instant response to disbalance) or at the account of 
modificat ions: methylat ion-dimethylat ion, phosphorylation-dephosphory-
lation etc. (fast response to disbalance) . If the consti tutive synthesis was 
really consti tut ive (i. e. permanent as a constant) then any reverse ca-
pacit ies of the enzymes would fall into disbalance too. In this case there 
must be a system reserv ing them in necessary quanti t ies, the system that 
cannot be regulated since the bulk of genes practice a consti tutive syn-
thesis. The consti tut ive synthesis is determined as the one that cannot 
react on the changes in the organism. So, there should be a regulat ion 
of the consti tutive expression. This regulat ion must be very prompt and 
necessari ly a complex one. It may be called a regulat ion by stabil ization 
«from the achieved». Var ia t ions of the synthesis from any consti tutive 
promoter are possible and really take place within certain limits. Control 
of the expression cannot be limited presently by only one promoter (even 
in genes of consti tutive synthesis) . There are always other sequences in-
volved into the control of the expression. Balanc ing of metabolic chains 
being constant ly changed under the action of internal and external di-
s turbances may be realized by the regulat ion of their s tabil izat ion by the 
central (most essential , dangerous etc.) process. This will be a regulat ion 
«from the achieved». Let us make an example. As a result of any distur-
bance but within the regulat ion there changes the content of protein Al 
(even locally in the l iver) . This change causes either increase or decre-
ase of the quant i ty of expressed (i. e. open for recognition) receptors 
(for Alj ITDLP, cholesterin or some other that is not s ignif icant for the 
JOO ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Nb 4 5 — 3-624 38 
regulat ion «from the achieved»). Such changes does not require new 
synthesis. It will be also regulated by the same mechanism «from the 
achieved». But it is a long process while ready molecules of the receptor 
are reserved in the membrane. Depending on Al (HDLP, eholesterin etc.)· 
their quant i ty is simply redistr ibuted. Closed (submerged) molecules 
t ransfer into an open s tate accessible for the reception or vice versa. 
Here is also a feedback but with a similar sign. The more is Al (HDLP, 
eholesterin etc.) the more are the receptors (the reserved ones have trans-
fered from the submerged into the open s ta te ) . The less is Al (HDLP, 
eholesterin etc.) the less is the quant i ty of open receptors (part of them 
is submerged into the membrane) . But this process cannot be continuous 
since the quant i ty of receptors is limited so the range of the response 
«from the achieved» is also limited. Receptors as connected w i t h ' t h e i r 
ligancis susta in expression of the genes in many fundamenta l ly connected 
metabolic chains. So the synthesis of proteins from the associated pro-
cesses should be oriented on the main, essential , dangerous etc. metaboHc 
process. Enhanc ing of the process enhances the rest. Its weakening in-
duces the same reaction. The process itself should be kept at a level 
«from the achieved». It makes the system stable. Otherwise the system 
will go wrack because of frequent oscillations. A range of the positive 
response (i. e. the whole molecular machine — a regula tory region of 
genes, receptors and their exposure, a s ignal from the receptors to the 
regulatory zone, a l igand recognized by the receptor an so on) will be 
this very range of the norm within which each cell of the organism is 
able to resist adequately and correspondingly to var ia t ions of outer and 
inner character . 
In this var ian t small amounts (with regard to the avai lable in і he 
organism) of either administered or locally synthesized product may exert 
an adequate reaction if they come to the reception system. The reception 
system allows for an increase of the product synthesis in response to the 
appearance of the same product with s imul taneous enhancement of other 
metabolic processes connected with it. But this level will exist till the 
next compensation and then the system will become stable on a level 
«from the achieved» etc. 
Further studies will show if the supposition is valid. 
Regulation of the expression is a principle moment for the gene the-
rapy of mass pathologies. It is solved by us ing consti tutive promoter-
enhancer system (frequently, nontissue-specif ic) . But it is not a regulated 
expression. If to clarify the types of regulat ion in its usual sense and 
in view of the gene therapy one may single out the following three prin-
ciples: 1 — « a s called for»; 2 — «as required»; 3 — «at will». 
The first one means that the regulat ion is expect ing its time. For 
example under embryogeny these or other groups of gene come into ac-
tion alterriaiingly In the course of the development. 
The second principle is a usual adaptive regulat ion. It means a res-
ponse to some action. 
The third type is the use of the potentiali t ies hidden in Lne second 
principles for the tasks, of gene therapy. P lac ing the required gene under 
the regulatory sequence induced by the hormone or heavy metal we may 
will ingly actualize its expression by int roducing the inductor. It is a wi-
despread model in the experiments on cell cultures and laboratory ani-
mals. But in its present form it is not suitable for people since we cannot 
intoxicate organism with heavy metals or destroy it with hormones for 
the sake of t rea tment . In due course there will be created systems for ac-
tual izat ion of genes «at will» applicable for human. Without going into 
par t iculars we may s ta te that such works are in progress though on cell 
cul tures so far . But for the time being there remains a consti tutive syn-
thesis with the regulat ion «from the achieved» (in case fu ture works con-
firm i t) . 
Classical hereditary diseases are on this case in more favourable 
conditions. Thero at least it is enough to implant gene with its own re-
ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. № 4 6 - 3-624 39 
gulatory region. The rest of the organism as genetically sound will ac-
cept it as a miss ing link of a s ingle whole. 
Finally it is very important and in future even s t ra tegic to demonstra-
te fundamenta l potential i t ies of gene therapy for age pathologies. The 
opened prospects to el iminate the grounds of the pathology in the age ing 
o rgan i sm needs fur ther analysis that is to be done. It is unusual in Iiris 
case that gene implantat ion el iminates the damage that is a consequence 
of. the age ing and thus is incurable in principle since the age ing is ine-
vitable, irreversible, natural and entropy-conditioned process with the 
only one way — to the better world. 
Agains t this background one tries to demonstra te a fundamenta l po-
tent ial i ty to parry the age pathology. Not the age ing on the whole but 
only one pathology. But even this chance makes the whole si tuation un-
steady. If it is possible to restore only one function by gene therapy then 
why not two or ten? And in the long run a man has about as few as fif-
ty thousand s t ructura l genes that is not so many. However not everything 
is so simple here. Only a detailed analysis and fur ther experiments will 
answer the questions s ta ted by potentiali t ies of gene therapy of mass 
pathologies. 
These are brief results of the performed studies. As it is a lways with 
the new — the wrorks rather s ta te new problems then solve the old ones 
but gene therapy of mass pathologies is on the agenda now demanding 
not only at tent ion. 
Р е з ю м е . Описано комплекс досліджень, яким дозволяє пройти шлях від ідеї 
до експериментального вирішення принципової можливості генної терапії масових па-
тологій, на прикладі інсулінзалежного цукрового діабету та атеросклерозу. 
Зроблено добір та аналіз регуляторних елементів, які дозволяють здійснювати 
експресію екзогенних генів незалежно від стану загальної клітинної регуляції . На 
клітинах різних тканин та організмів, а т а к о ж in vivo показано експресію генетич-
ного матеріалу, що вводиться (як модельного гена бактеріальної β -галактозидази, так 
і генів інсуліну та аполіпопротеїну високої щільності Al, які мають відношення до ви-
щезгаданих патологїй) . 
Відзначено неправомірність екстраполяці ї результатів, отриманих в культурі 
клітин, на тварин; показано неоднозначність експресії рекомбінантних молекул за-
л е ж н о від генного оточення і типу клітин-реципієнтів. Як в культурі клітин, так і в 
організмові виявлено індивідуально-клітинну гетерогенність кількісних характеристик 
експресі: введеного ззовні гена. Крім того, відзначено індивідуально-організмову та 
вікову гетерогенність експресії екзогенної інформації . 
Зроблено висновок про необхідність індивідуалізаці ї генної терапії масових па-
тологів. 
R E F E R E N C E S 
1. Кордюм В. А. З а д а ч и и проблемы генной терапии // Виополимепы и клетка.— 
19-89.— 5, № 2.— С. 5—16. 
2. Кордюм В. А. Возможности генной терапии д л я лечения и профилактики массо-
вых патологий // Там же — 1990,— 6, № 1.—С. 12—31. 
3. Миллер Дою. Эксперименты в молекулярной генетике.— М. : Мир, 19'76.— 430 с. 
4. Гловер Д . Клонирование Д Н К - — M . : Мир, 1988 — 538 с. 
5. Storms R. К, McNeil J. В., Khandekar P. S. et al. Chimeric p lasmids for c loning 
of deoxyribonucleic acid sequences in Saccharomnces cerevisiae // J. Bacteriol.— 
1979— 140, N 1 . — P . 73—82. 
6. Simitiovitch L. Express ion of bacter ial β - g a l a c t o s i d a s e in an imal cells // Moi. and 
Cell. B io l .—1982 ,—2, N 12 .—P. 1628—1632. 
7. Маниатис Т., Фрич Э., Сэмбрук Д. Молекулярное клонирование.— М. : Мир, 1984.— 
4'79 с. 
8. Мирошниченко Г. П.. Дьяченко А. Ф. Современные методы выделения ДМ К из 
высших растений / / Успехи соврем, ,биологии.— 19Ш.— 91, № 1.— С. 49—60. 
9. Maxam A. M., Gilbert W. Sequenc ing end-labelled DNA with base-specific chemical 
c leavages / / Meth. E n z y m o l . — 1 9 9 0 . — 6 5 , pt. 1.— P. 499—560. 
10. Билнч К. M., Иродов Д. M., Кордюм В. А. Некоторые ультраструктурные аспекты 
прямой инъекции липосом, содержащих плазмидную Д Н К , и печень мыши // 
Биополимеры и клетка.— 1 9 9 0 - в, .Ny 1.— С. 73- -82. 
102 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. .Ν1·· ·ί 
Tl . Зильбер А. Иммунологический анализ.— Μ. : Медицина, 1968.— 185 с. 
12. Нммуноферментныи анализ // П о д ред. Т. Нго, Г. Ленхоффа .— М. : Мир, 1988.— 
446 г. 
.13. Van der Eb A. I., Graham F. L. A new technique for the a s say of infect ivi ty of hu-
man adenovi rus 5 DNA / / Virology.— 1973.—52, N 2 . — P . 456—467. 
14. Гааль Э., Медьеши Г., Верецки Л. Электрофорез в разделении биологических 
макромолекул . - - М. : Мир, 19'82 — 446 с. 
15. Abetl L. L., Lerey В. В., Brodie В. В., Kendall F. Ε. A simplified method for the 
es t imat ion of total cholesterol in se rum and demons t ra t ion of its specificity // J. Biol. 
C h e m . - 1952,— 195, N 1 . — P . 357—366. 
16 ,Киряков Α., Tumepoea 3. Определение холестерина и триглицерилов в липопроте-
идах сыворотки крови, выделенных методом двойной преципитации // Л а б . дело.— 
1979.—-ЛІ» 7.— С. 3 9 8 - 4 0 2 . 
17. Киряков А., Тинтеропа 3., Стоянова С. Электрофореза на серумните липопротеини 
въерху агарозеп гсл /7 Сьевр. медицина.— 1977.— 28, № 4.— С. 29і—35. 
.18. Климов Α. II., Усатенко М. С., Денисенко А. Д. и др. Выделение аполнпопротеинов 
A-I, A-II и Е, их определение методом ракетного иммуиофореза в плазме к ρ-ж и 
больных дисальфа-липопротеидемией // Биохимия.— 1980.— 46, ΛΊ> 4.— С. 589і 602. 
19. Markwell Al, Haas S. M., Riber L. L. el al. A modif icat ion of the Loury procedure 
to s impl i fy protein de termina t ion in membrane and l ipoprotein samples // Anal . 
Biochem.— 1988.— 87, N 1 . — P . 206—210. 
20. Кейт с AL Техника липидологии.— Μ. : Мир, 1075.— 332 с. 
21. Svauborh Α., Svenercholm L. P l a s m a lipid, cholesterol, phospholipids and fat acids in 
heal thy Scandinavian populat ion // Acta. Med. Scand .—1961 .— 109, N I , — P . 43—19. 
22. Swaney I. B., Kuchl K. S. Separa t ion of apol ipoproteins by an ac ry lamide-grad ien t 
sodium dodecyl su l fa te gel electrophoresis svs tem // Biochem. et biophys. acta .— 
1987.—446, N 2,— P. 561—565. 
23. Laemmli Y. K. C leavage of s t ruc tura l proteins du r ing the assembly of the liead of 
bacter iophage T4 // Nature .— 1970,—227, N 5 2 5 9 , — P . 680—685. 
24. Карузина И. ИАрканов А. И. Выделение микроеомной фракции печени и ха-
рактеристика ее окислительных систем // Соврем, методы в биохимии.— М. : Ме-
дицина, 1977.— С. 49—62. 
25. Gmura Т., Saio R. The carbon monooxide b inding p igment of liver microsomes. II. 
Solubil izat ion, purif icat ion, and propert ies // J. Biol. Chem.— 1964.— 239, N 7.— 
P. 2379—2385. 
26. Эрнст Б., Тесман Д. Иммунология // Иммун-ол. методы.— М. : Мир, 1970.— С. 373— 
413. 
.27. Rhodes J. ΑΙ., Blom J. Cytochemical localization of β -ga lac tos idase in resident and 
in f l ammato ry peri toneal mac ro fages f rom C57BL mice // His tochemist ry .— 1986.— 
86, N 2 . — P . 159—161. 
28. Кириллова В. С., Иродов Д. Ai., Усенко Е. В. и до, Исследование экспрессии гена 
IacZ Е. coli в культуре L-клеток // Новые направления биотехнологии : Тез. докл. 
Всесоюз. конф.--- 1988.— С. 8—10. 
29. Kordium V. A., Kostelsky I. E., Shpilevaya S. P. et al. Studies of recombinant expres-
sion in var ious an imals t issue cells // II Symp. U S S R — U S A . — Moscow, 1989. 
30. Нарзанова И. C.. Неборачко Л. Ii., Шпилевая С. П. и др. Сравнительное изуче-
ние экспрессии модельного гена бактериальной β -галактозидазы в культуре фибро-
пластов 'МЫIHи и при прямом введении в печень животного IJ Биополимеры и клет-
ка.— 1S90.— 6, № 1,—С. 67—73, 
31. Шпилевая С. П., Лихачева Л. И., Варзанова И. С. и др. Экспрессия IacZ гена 
/:. coli в культурах клеток млекопитающих // Геном человека : I Всесоюз. конф.— 
і 990.— С. 143--444. 
• 32. Костецкий И. E.. Шпилевая С. П., Лихачева Л. И. и др. Экспрессия IacZ гена 
И. coli в клетках млекопитающих // Там же.— С. It 19·—120. 
33. Костецкий И. Е. Шпилевая С. П., Лихачева Л. И. и др. Экспрессия β-галакто-
зидазы Escherichia coli в гепатоцитах мыши // Биополимеры и клетка.— 1989.— 
5. № 2 . — С . 51—58. 
34. Шпилевая С. П., Костецкий И. E., Лихачева Л. И. и др. Сравнительное изучение 
эффективности экспрессии бактериальной β -галактозидазы in vivo с помощью им-
муноферментного анализа / / Там же.— 1990.— 6, № 1.— С. 63>—66. 
35. Мазовецкий A. F.. Великое В. II. Сахарный диабет.— М. : Медицина, 1'9'87.— 288 с. 
36. Shoelsoti S., Fickova Al, Hanada Al et al. Ident i f icat ion of a m u t a n t human insu-
lin predicted to contain a serine for phenyla lanine subs t i tu t ion // Proc. Nat . Acad. 
Sci. USA.— 1983.—80, N 2 4 , — P . 7390—7394. 
37. Biech N. P., Christie D. L., Renwick A. G. C. Proinsul in-I ike mater ia l in mouse fietal 
brain cell cul tures // F E B S Lett .— 1984,— 168, N 2 , — P . 299—302. 
38. Walker Al. D., Edlung Th., Boulet A. Al , Rutter W. I. Cell-specific expression control-
led by 5 - f l ank ing region of insulin and chymotryps in genes / / Nature .— 1983.— 
306, N 5943 ,—P. 557—561. 
39. Niven AL I., Hitman G. A. The molecular genet ics of diabetes mel i tus / / Biosci. 
Repts.— 1986 — 6, N 6 , — P . 501—512. 
40. Laub O., Rail L., Bell G. I., Putter W. I. Express ion of the h u m a n insulin gene in 
an a l t e rna te m a m m a l i a n cell and cell ext rac ts // J. Biol. Chem.— 1983.— 258, N 10 — 
P. 6037—6042. 
41. Gluzman Y. SV40 t r ans fo rmed s imian cells suppor t the replication of ear ly SV40 
m u t a n t s // Cel l .—1981.— 23, N 1 ,—P. 175—182. 
ISSN 0233-7057. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. Яв 4 7* № 
42. Неборачко Л. H., JI у каш JI. JI., Трояновский Б. М. и др. Исследование возмож-
ности экспрессии экзогенного гена инсулина человека в культивируемых фибро-
бластах млекопитающих // Биополимеры и клетка.— 19'8'9.— 5, № 2.— С. 58—-150. 
43. JI у каш JI. JI., Неборачко JI. H., Подольская С. В. и др. Экспрессия экзогенного 
гена инсулина человека в субкультурах и клонах культивируемых фибробластов 
человека Il Д о м , АН У С С Р , - Шд - № 8 , - С . 71—74. 
44. Лукаш JI. JI., Неборачко JI. H., Трояновский Б. М. Экспрессия экзогенного гена 
инсулина человека в культивируемых фибробластах млекопитающих // Генная и 
клеточная инженерия в решении фундаментальных проблем биотехнологии : Мате-
риалы Всесоюз. конф. (Тарту-Кяэрику, 20—22 сентября, 11988).— Тартус. гос. 
ун-т, 1989.—Т. 1.— 200 с. 
45. Cline М. Y., Slang H., Mercola К. et al. Gene t r ans fe r in intact an imals / / Nature .— 
1980 .—284 .—P. 422—425. 
46. Van Wyke K. LHinshom W. J., Beam W. J. et al. Ant igen var ia t ion of inf luenza A 
vi rus nucleoprotein detected with monoclonal ant ibodies // J. Virol.— !980.— 35, 
N 1 . — P . 24—80. 
47. Лукаш Л. Л., Неборачко JL II., Сухорада Ε. Μ. и др. Экспрессия гена инсулина 
человека в культивируемых клетках млекопитающих // Биополимеры и клетка.— 
1990.— 6, № 1,—С. 82—87. 
48. Титок Т. Г., Костецкий И. E., Чайковская Т. И. и др. Перенос гена препроинсу-
лина человека крысам с искусственно вызванным диабетом // Там же.— № 2.— 
С. 76—80. 
49. Титок Т. L., Костецкий И. E., Варзанова И. С. и др. Трансплантация гена инсу-
лина человека в организм здоровых и больных диабетом крыс // Там же.— 199С1— 
9, № 1.—С. 339—345. 
50. Deker К Biological ly active produc ts of s t imula ted liver m a c r o p h a g e s (Kupf fe r 
cells) // Eur . J . Biochem.— 1990.— 192, N 2 . — P . 245—261. 
51. Ляшенко Β. Α., Дроженников В. Α., Молотковская И. Ni. Механизмы активации 
иммунокомпетентных клеток.— М. : Медицина, 1988.— 238 с. 
5*2. Cordle S. R., Whehan J., Henderson E. et al. Insul in gene expression in nonexpres-
s ing cells appea r s to be regu la ted by mult iple d i s t ing nega t ive -ac t ing control ele-
men t s // Мої. Biol, and E v o l . - 1 9 9 1 . — 8 , N 5 . — P . 2881—2886. 
53. Cordell B., Disrnond D., Smith S. et al. Dispropor t iona te expression of the t w o 
nonallel ic insulin genes in a pancrea t ic tumor is due to t r ans la t iona l control // 
Ce l l .—1982 ,—31, N 2 , — P . 531—542. 
54. Репин В. С. Атеросклероз человека: клеточные и молекулярные механизмы // 
Успехи соврем. биологии — 1990.— 109, № 1 . — С . 120—129. " 
55. IU ульо/сенко В. H., Новикова С. H., Костецкий И. Е. и др. Имплантация клони-
рованного гена a n o A l человека взрослым и старым кролям // Биополимеры и клет-
ка.— 1990.— 6, № 2 . — С . 71—76. 
56. Shoulders С. С., Baralle F. Е. Isolat ion of h u m a n HDL apoprotein Al gene // 
Proc. Nat . Acad. Sci. USA.— 1982.— 10, N 1 6 . — P . 4873—4882. 
57. Шахмурадов И. Α., Колчанов Η. Α., Соловьев В. В., Ратнер В. А. Эихансерноно-
добные структуры в умеренно повторяющихся последовательностях эукариотиче-
ских геномов // Г е н е т и к а — 1 9 # 6 — 2 2 , №? 3 . — С . 104—106. 
58. Ш ульженко В. H., Лукаш Л. Л., Ul у ляк А. Н. и др. Клонирование гена anoAl че-
ловека и его экспрессия в фибробластах мыши // Биополимеры и клетка, - 1989.— 
5, JYo 5 . _ с. 105—107. 
59. Ulульженко В. H., Кордюм В. А. Клонирование последовательностей Д Н К генома 
кукурузы, способных к автономной репликации в Saccharomyces eerevisiae Ц 
Там же.— 1987.— 3, № 5,— С. 270—274. 
60. Кордюм В. А., Труханов В. А., Топорова Е. К. и др. Репликация в протопластах 
табака рекомбинантной Д Н К // Там же,— № 3.— С. 145—148. 
61. Фролькис В. В., Кордюм В. А., Богацкая Л. IL и др. Имплантация гена atioAI 
человека старым животным // Докл . АН CCiCP.— 4991.— 316, JVb 5 ,—С. 1264— 
1269'. 
62. Фролькис В. В., Кордюм В. А., Богацкая Л. Н. и др. Возрастные особенности 
влияния имплантации гена atioAI человека на развитие дислипопротеинемии у 
экспериментальных животных // Биополимеры и клетка.— 1991.— 1, № 2 ,—С. 103'— 
109. 
63. Frolkis V. V., Kordium V. A., Bogatskaya L. N. et al. Effect of t r ans fe r of human 
ApoAl gene on development of dys l ipoprote inemias in ra t s : Age peculiari t ies If 
Arch. Gerontol . Ger ia t r .— 1991 .—13 .—P. 225—236. 
64. Korclium V. A. Gene t r e rapy is inevitable. But shall we have t ime?.— Kiev, 1991.— 
91 p. 
65. Keijiro Saku, Kyosuke Yamamotol Tokahiro Sakai et al. Kinetics of HDl-apoAl in 
the W H H L rabbit , an animal model of familial hypercholesterolemia // Atherosclero-
s i s . — 1 9 8 9 , — 7 9 . — P . 225—236. 
66. Кордюм В. А. Проблема выживания : от кратковременного пребывания к постоян-
ному обитанию в экстремальных УСЛОВИЯХ / / Биополимеры и клетка.—199'2.— 8. 
JVo 2,— С. 3—37. 
Ins t i tu te of Molecular Biology and Genetics 15.09.92 
Acad. Ox Sci. of Ukraine, Kiev 
104 ISSN 0233-7657. Б И О П О Л И М Е Р Ы И КЛЕТКА. 1993. Т. 9. .Ν1·· ·ί